Incidental Mutation 'R7645:Psmb8'
List |< first << previous [record 31 of 48] next >> last >|
ID590504
Institutional Source Beutler Lab
Gene Symbol Psmb8
Ensembl Gene ENSMUSG00000024338
Gene Nameproteasome (prosome, macropain) subunit, beta type 8 (large multifunctional peptidase 7)
SynonymsLmp7, Lmp-7
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7645 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location34197721-34201454 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34200212 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 160 (L160P)
Ref Sequence ENSEMBL: ENSMUSP00000025196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025196] [ENSMUST00000025197] [ENSMUST00000041633] [ENSMUST00000131105] [ENSMUST00000138491] [ENSMUST00000170086] [ENSMUST00000173441]
PDB Structure
Mouse 20S immunoproteasome in complex with PR-957 [X-RAY DIFFRACTION]
Mouse 20S immunoproteasome [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025196
AA Change: L160P

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000025196
Gene: ENSMUSG00000024338
AA Change: L160P

DomainStartEndE-ValueType
Pfam:Proteasome 69 251 1.9e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025197
SMART Domains Protein: ENSMUSP00000025197
Gene: ENSMUSG00000024339

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
transmembrane domain 97 119 N/A INTRINSIC
Pfam:ABC_membrane 151 419 1.8e-62 PFAM
AAA 494 678 2.58e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000041633
SMART Domains Protein: ENSMUSP00000039264
Gene: ENSMUSG00000037321

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
transmembrane domain 116 138 N/A INTRINSIC
Pfam:ABC_membrane 163 420 9.1e-55 PFAM
AAA 478 666 2.21e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131105
SMART Domains Protein: ENSMUSP00000118700
Gene: ENSMUSG00000024339

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138491
Predicted Effect probably benign
Transcript: ENSMUST00000170086
SMART Domains Protein: ENSMUSP00000128401
Gene: ENSMUSG00000037321

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
transmembrane domain 116 138 N/A INTRINSIC
Pfam:ABC_membrane 163 434 5.8e-70 PFAM
AAA 506 694 2.21e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000173441
AA Change: L160P

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134664
Gene: ENSMUSG00000024338
AA Change: L160P

DomainStartEndE-ValueType
Pfam:Proteasome 69 248 6.3e-53 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit. This gene is located in the class II region of the MHC (major histocompatibility complex). Expression of this gene is induced by gamma interferon and this gene product replaces catalytic subunit 3 (proteasome beta 5 subunit) in the immunoproteasome. Proteolytic processing is required to generate a mature subunit. Two alternative transcripts encoding two isoforms have been identified; both isoforms are processed to yield the same mature subunit. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display an essentially normal phenotype. However they have a reduced ability to process MHC class I restricted antigens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actbl2 T A 13: 111,256,255 C375S probably benign Het
Adgrg3 A G 8: 95,034,764 probably benign Het
Amn1 C T 6: 149,185,031 M44I probably benign Het
Atg2b T C 12: 105,623,430 Y1854C probably benign Het
Bcat2 T A 7: 45,587,963 N290K probably benign Het
Ccdc39 T C 3: 33,825,169 probably null Het
Cnot10 T C 9: 114,613,637 S501G probably benign Het
Col6a6 A G 9: 105,767,198 probably null Het
Coq2 A C 5: 100,660,250 C228W probably damaging Het
Cpt2 A T 4: 107,906,974 M531K possibly damaging Het
Dennd1a A G 2: 38,021,363 L204P probably damaging Het
Dirc2 T A 16: 35,734,068 probably null Het
Dock9 C T 14: 121,597,663 V1305M probably benign Het
Dusp16 A G 6: 134,725,925 I201T probably damaging Het
Esco2 T C 14: 65,827,181 D370G probably benign Het
Fbxl4 T C 4: 22,377,037 S158P probably damaging Het
Fut10 A G 8: 31,236,204 H329R possibly damaging Het
Gm10436 T C 12: 88,176,258 T392A probably damaging Het
Gpr3 A G 4: 133,211,329 W11R probably damaging Het
H2-M3 T A 17: 37,270,729 I94N probably damaging Het
Krt7 T C 15: 101,412,643 I57T probably damaging Het
Ltc4s T C 11: 50,238,546 probably benign Het
Ms4a6b A T 19: 11,523,940 T105S probably damaging Het
Muc6 T C 7: 141,648,658 H592R probably benign Het
Ncam1 T C 9: 49,565,003 E262G probably benign Het
Olfr1265 T A 2: 90,037,747 I276K possibly damaging Het
Olfr1462 T C 19: 13,191,573 V302A probably benign Het
Plxnb1 T A 9: 109,114,412 S1908T probably damaging Het
Polg2 A T 11: 106,775,593 M242K probably benign Het
Polr3g T C 13: 81,694,444 T151A unknown Het
Rab5b G A 10: 128,681,391 A176V possibly damaging Het
Rreb1 T C 13: 37,931,034 C790R probably damaging Het
Rufy3 A G 5: 88,640,617 T506A probably benign Het
Samd11 T C 4: 156,255,183 probably benign Het
Slc12a2 T C 18: 57,896,378 F279L possibly damaging Het
Son TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCAGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,295 probably benign Het
Srgn C T 10: 62,494,978 W116* probably null Het
Svil A G 18: 5,099,663 E1733G probably damaging Het
Tbc1d22a C T 15: 86,235,541 P49S probably benign Het
Tbc1d9 A T 8: 83,242,553 K490M probably damaging Het
Tcte1 A G 17: 45,534,989 N173S probably benign Het
Tmco6 C T 18: 36,735,393 R31W probably damaging Het
Ttn C A 2: 76,899,681 A5155S unknown Het
Tyro3 T C 2: 119,816,906 Y839H probably damaging Het
Zc3h12d A G 10: 7,867,576 D370G probably benign Het
Zc3h7b T C 15: 81,780,602 L554P probably damaging Het
Zfp352 C T 4: 90,224,777 P385S probably benign Het
Other mutations in Psmb8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00817:Psmb8 APN 17 34200729 missense probably damaging 0.97
IGL01153:Psmb8 APN 17 34201241 missense possibly damaging 0.82
IGL01307:Psmb8 APN 17 34199236 missense probably benign
IGL01394:Psmb8 APN 17 34200729 missense probably damaging 1.00
IGL01821:Psmb8 APN 17 34198543 missense probably benign
IGL01936:Psmb8 APN 17 34200194 missense probably damaging 1.00
IGL02118:Psmb8 APN 17 34201224 missense probably damaging 0.98
IGL02708:Psmb8 APN 17 34201243 missense probably benign 0.00
IGL02739:Psmb8 APN 17 34200754 nonsense probably null
R1952:Psmb8 UTSW 17 34200910 missense probably damaging 1.00
R2869:Psmb8 UTSW 17 34200170 missense probably damaging 0.98
R2869:Psmb8 UTSW 17 34200170 missense probably damaging 0.98
R2870:Psmb8 UTSW 17 34200170 missense probably damaging 0.98
R2870:Psmb8 UTSW 17 34200170 missense probably damaging 0.98
R2871:Psmb8 UTSW 17 34200170 missense probably damaging 0.98
R2871:Psmb8 UTSW 17 34200170 missense probably damaging 0.98
R2873:Psmb8 UTSW 17 34200170 missense probably damaging 0.98
R2874:Psmb8 UTSW 17 34200170 missense probably damaging 0.98
R5632:Psmb8 UTSW 17 34201240 missense probably benign
R6395:Psmb8 UTSW 17 34199291 missense possibly damaging 0.86
R6993:Psmb8 UTSW 17 34199643 missense probably damaging 1.00
R7672:Psmb8 UTSW 17 34198430 missense probably benign 0.06
Z1176:Psmb8 UTSW 17 34200856 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTAGGCTTTTAAAATGCGGATCAG -3'
(R):5'- ACAGCACACTTTGGTAAACATC -3'

Sequencing Primer
(F):5'- GCGGATCAGAGATTTTAAATTCCC -3'
(R):5'- GTTCAATGGGTAAGACACC -3'
Posted On2019-10-24