Incidental Mutation 'R7645:H2-M3'
ID590505
Institutional Source Beutler Lab
Gene Symbol H2-M3
Ensembl Gene ENSMUSG00000016206
Gene Namehistocompatibility 2, M region locus 3
SynonymsH-2M3, Hmt, R4B2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7645 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location37270220-37274484 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37270729 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 94 (I94N)
Ref Sequence ENSEMBL: ENSMUSP00000035687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038580]
PDB Structure
MODEL OF MHC CLASS I H2-M3 WITH NONAPEPTIDE FROM RAT ND1 REFINED AT 2.3 ANGSTROMS RESOLUTION [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000038580
AA Change: I94N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000035687
Gene: ENSMUSG00000016206
AA Change: I94N

DomainStartEndE-ValueType
Pfam:MHC_I 25 203 6.6e-76 PFAM
IGc1 222 293 4.91e-21 SMART
transmembrane domain 306 328 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HLA-G belongs to the HLA class I heavy chain paralogues. This class I molecule is a heterodimer consisting of a heavy chain and a light chain (beta-2 microglobulin). The heavy chain is anchored in the membrane. HLA-G is expressed on fetal derived placental cells. The heavy chain is approximately 45 kDa and its gene contains 8 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the alpha1 and alpha2 domain, which both bind the peptide, exon 4 encodes the alpha3 domain, exon 5 encodes the transmembrane region, and exon 6 encodes the cytoplasmic tail. [provided by RefSeq, Jul 2008]
PHENOTYPE: At least three alleles are known for this locus: allele a, found in C57BL/6, C3H-Pgk1a, NZO and NMRI, and allele c, found in M. spretus determine distinct antigen specificities. Allele b, found in M.m. castaneus results in absence of antigen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actbl2 T A 13: 111,256,255 C375S probably benign Het
Adgrg3 A G 8: 95,034,764 probably benign Het
Amn1 C T 6: 149,185,031 M44I probably benign Het
Atg2b T C 12: 105,623,430 Y1854C probably benign Het
Bcat2 T A 7: 45,587,963 N290K probably benign Het
Ccdc39 T C 3: 33,825,169 probably null Het
Cnot10 T C 9: 114,613,637 S501G probably benign Het
Col6a6 A G 9: 105,767,198 probably null Het
Coq2 A C 5: 100,660,250 C228W probably damaging Het
Cpt2 A T 4: 107,906,974 M531K possibly damaging Het
Dennd1a A G 2: 38,021,363 L204P probably damaging Het
Dirc2 T A 16: 35,734,068 probably null Het
Dock9 C T 14: 121,597,663 V1305M probably benign Het
Dusp16 A G 6: 134,725,925 I201T probably damaging Het
Esco2 T C 14: 65,827,181 D370G probably benign Het
Fbxl4 T C 4: 22,377,037 S158P probably damaging Het
Fut10 A G 8: 31,236,204 H329R possibly damaging Het
Gm10436 T C 12: 88,176,258 T392A probably damaging Het
Gpr3 A G 4: 133,211,329 W11R probably damaging Het
Krt7 T C 15: 101,412,643 I57T probably damaging Het
Ltc4s T C 11: 50,238,546 probably benign Het
Ms4a6b A T 19: 11,523,940 T105S probably damaging Het
Muc6 T C 7: 141,648,658 H592R probably benign Het
Ncam1 T C 9: 49,565,003 E262G probably benign Het
Olfr1265 T A 2: 90,037,747 I276K possibly damaging Het
Olfr1462 T C 19: 13,191,573 V302A probably benign Het
Plxnb1 T A 9: 109,114,412 S1908T probably damaging Het
Polg2 A T 11: 106,775,593 M242K probably benign Het
Polr3g T C 13: 81,694,444 T151A unknown Het
Psmb8 T C 17: 34,200,212 L160P possibly damaging Het
Rab5b G A 10: 128,681,391 A176V possibly damaging Het
Rreb1 T C 13: 37,931,034 C790R probably damaging Het
Rufy3 A G 5: 88,640,617 T506A probably benign Het
Samd11 T C 4: 156,255,183 probably benign Het
Slc12a2 T C 18: 57,896,378 F279L possibly damaging Het
Son TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCAGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,295 probably benign Het
Srgn C T 10: 62,494,978 W116* probably null Het
Svil A G 18: 5,099,663 E1733G probably damaging Het
Tbc1d22a C T 15: 86,235,541 P49S probably benign Het
Tbc1d9 A T 8: 83,242,553 K490M probably damaging Het
Tcte1 A G 17: 45,534,989 N173S probably benign Het
Tmco6 C T 18: 36,735,393 R31W probably damaging Het
Ttn C A 2: 76,899,681 A5155S unknown Het
Tyro3 T C 2: 119,816,906 Y839H probably damaging Het
Zc3h12d A G 10: 7,867,576 D370G probably benign Het
Zc3h7b T C 15: 81,780,602 L554P probably damaging Het
Zfp352 C T 4: 90,224,777 P385S probably benign Het
Other mutations in H2-M3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01630:H2-M3 APN 17 37270657 missense possibly damaging 0.89
IGL01891:H2-M3 APN 17 37272717 missense probably benign 0.23
IGL02689:H2-M3 APN 17 37270541 nonsense probably null
IGL02755:H2-M3 APN 17 37271022 missense possibly damaging 0.81
IGL02994:H2-M3 APN 17 37270738 missense probably benign
IGL03135:H2-M3 APN 17 37272433 missense possibly damaging 0.90
IGL03177:H2-M3 APN 17 37270316 missense possibly damaging 0.86
R1328:H2-M3 UTSW 17 37271034 missense possibly damaging 0.71
R1632:H2-M3 UTSW 17 37271163 missense probably benign 0.01
R1919:H2-M3 UTSW 17 37271189 missense possibly damaging 0.67
R3981:H2-M3 UTSW 17 37271130 missense probably damaging 0.97
R4304:H2-M3 UTSW 17 37272404 missense probably benign 0.07
R4620:H2-M3 UTSW 17 37272419 missense probably damaging 0.97
R5765:H2-M3 UTSW 17 37272443 missense probably damaging 0.97
R7262:H2-M3 UTSW 17 37271193 missense probably damaging 1.00
R7437:H2-M3 UTSW 17 37272678 missense probably benign 0.23
R7585:H2-M3 UTSW 17 37270708 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGCGCTATTTCCACACTG -3'
(R):5'- TTGGACCTAAACTGAAAGTGAAACC -3'

Sequencing Primer
(F):5'- CACTGCGGTGTCACGGC -3'
(R):5'- ACCGGTTAAAGGTTTCTGAGAGCTC -3'
Posted On2019-10-24