Incidental Mutation 'R7645:Ms4a6b'
ID590510
Institutional Source Beutler Lab
Gene Symbol Ms4a6b
Ensembl Gene ENSMUSG00000024677
Gene Namemembrane-spanning 4-domains, subfamily A, member 6B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7645 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location11516512-11531256 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 11523940 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 105 (T105S)
Ref Sequence ENSEMBL: ENSMUSP00000025580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025580] [ENSMUST00000161157] [ENSMUST00000161283] [ENSMUST00000163078]
Predicted Effect probably damaging
Transcript: ENSMUST00000025580
AA Change: T105S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000025580
Gene: ENSMUSG00000024677
AA Change: T105S

DomainStartEndE-ValueType
Pfam:CD20 47 204 2.8e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161157
AA Change: T105S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125519
Gene: ENSMUSG00000024677
AA Change: T105S

DomainStartEndE-ValueType
Pfam:CD20 47 117 8e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161283
AA Change: T56S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124277
Gene: ENSMUSG00000024677
AA Change: T56S

DomainStartEndE-ValueType
Pfam:CD20 1 69 9.2e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163078
AA Change: T105S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000124685
Gene: ENSMUSG00000024677
AA Change: T105S

DomainStartEndE-ValueType
Pfam:CD20 47 204 4.2e-41 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actbl2 T A 13: 111,256,255 C375S probably benign Het
Adgrg3 A G 8: 95,034,764 probably benign Het
Amn1 C T 6: 149,185,031 M44I probably benign Het
Atg2b T C 12: 105,623,430 Y1854C probably benign Het
Bcat2 T A 7: 45,587,963 N290K probably benign Het
Ccdc39 T C 3: 33,825,169 probably null Het
Cnot10 T C 9: 114,613,637 S501G probably benign Het
Col6a6 A G 9: 105,767,198 probably null Het
Coq2 A C 5: 100,660,250 C228W probably damaging Het
Cpt2 A T 4: 107,906,974 M531K possibly damaging Het
Dennd1a A G 2: 38,021,363 L204P probably damaging Het
Dirc2 T A 16: 35,734,068 probably null Het
Dock9 C T 14: 121,597,663 V1305M probably benign Het
Dusp16 A G 6: 134,725,925 I201T probably damaging Het
Esco2 T C 14: 65,827,181 D370G probably benign Het
Fbxl4 T C 4: 22,377,037 S158P probably damaging Het
Fut10 A G 8: 31,236,204 H329R possibly damaging Het
Gm10436 T C 12: 88,176,258 T392A probably damaging Het
Gpr3 A G 4: 133,211,329 W11R probably damaging Het
H2-M3 T A 17: 37,270,729 I94N probably damaging Het
Krt7 T C 15: 101,412,643 I57T probably damaging Het
Ltc4s T C 11: 50,238,546 probably benign Het
Muc6 T C 7: 141,648,658 H592R probably benign Het
Ncam1 T C 9: 49,565,003 E262G probably benign Het
Olfr1265 T A 2: 90,037,747 I276K possibly damaging Het
Olfr1462 T C 19: 13,191,573 V302A probably benign Het
Plxnb1 T A 9: 109,114,412 S1908T probably damaging Het
Polg2 A T 11: 106,775,593 M242K probably benign Het
Polr3g T C 13: 81,694,444 T151A unknown Het
Psmb8 T C 17: 34,200,212 L160P possibly damaging Het
Rab5b G A 10: 128,681,391 A176V possibly damaging Het
Rreb1 T C 13: 37,931,034 C790R probably damaging Het
Rufy3 A G 5: 88,640,617 T506A probably benign Het
Samd11 T C 4: 156,255,183 probably benign Het
Slc12a2 T C 18: 57,896,378 F279L possibly damaging Het
Son TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCAGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,295 probably benign Het
Srgn C T 10: 62,494,978 W116* probably null Het
Svil A G 18: 5,099,663 E1733G probably damaging Het
Tbc1d22a C T 15: 86,235,541 P49S probably benign Het
Tbc1d9 A T 8: 83,242,553 K490M probably damaging Het
Tcte1 A G 17: 45,534,989 N173S probably benign Het
Tmco6 C T 18: 36,735,393 R31W probably damaging Het
Ttn C A 2: 76,899,681 A5155S unknown Het
Tyro3 T C 2: 119,816,906 Y839H probably damaging Het
Zc3h12d A G 10: 7,867,576 D370G probably benign Het
Zc3h7b T C 15: 81,780,602 L554P probably damaging Het
Zfp352 C T 4: 90,224,777 P385S probably benign Het
Other mutations in Ms4a6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Ms4a6b APN 19 11529490 missense possibly damaging 0.72
IGL01373:Ms4a6b APN 19 11529507 missense possibly damaging 0.71
IGL03258:Ms4a6b APN 19 11521708 missense probably damaging 1.00
R0443:Ms4a6b UTSW 19 11521680 missense possibly damaging 0.95
R0616:Ms4a6b UTSW 19 11526898 critical splice donor site probably null
R1649:Ms4a6b UTSW 19 11520442 missense possibly damaging 0.94
R1826:Ms4a6b UTSW 19 11523934 missense probably damaging 1.00
R3964:Ms4a6b UTSW 19 11521734 missense probably benign 0.01
R3966:Ms4a6b UTSW 19 11521734 missense probably benign 0.01
R5380:Ms4a6b UTSW 19 11521680 missense probably damaging 1.00
R5862:Ms4a6b UTSW 19 11521803 missense probably benign 0.13
R5922:Ms4a6b UTSW 19 11520379 missense possibly damaging 0.94
R6048:Ms4a6b UTSW 19 11520370 missense possibly damaging 0.62
R6120:Ms4a6b UTSW 19 11521695 missense probably benign 0.24
R6371:Ms4a6b UTSW 19 11520364 missense probably damaging 1.00
R7057:Ms4a6b UTSW 19 11526889 missense possibly damaging 0.79
R7253:Ms4a6b UTSW 19 11520396 missense probably benign 0.26
R7516:Ms4a6b UTSW 19 11529543 missense probably benign
R7543:Ms4a6b UTSW 19 11521791 missense not run
Z1176:Ms4a6b UTSW 19 11529486 critical splice acceptor site probably null
Z1177:Ms4a6b UTSW 19 11520423 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TCTCTCCTTGTAGGTCAAAGC -3'
(R):5'- TGGTCTCAGACATCAGGCAC -3'

Sequencing Primer
(F):5'- CTCCTTGTAGGTCAAAGCATAGACTC -3'
(R):5'- GGTCTCAGACATCAGGCACACTATG -3'
Posted On2019-10-24