Incidental Mutation 'R7645:Olfr1462'
ID590511
Institutional Source Beutler Lab
Gene Symbol Olfr1462
Ensembl Gene ENSMUSG00000094721
Gene Nameolfactory receptor 1462
SynonymsGA_x6K02T2RE5P-3517488-3518411, MOR202-13
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R7645 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location13185734-13193775 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13191573 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 302 (V302A)
Ref Sequence ENSEMBL: ENSMUSP00000147174 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076832] [ENSMUST00000208533]
Predicted Effect probably benign
Transcript: ENSMUST00000076832
AA Change: V302A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000076107
Gene: ENSMUSG00000094721
AA Change: V302A

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.3e-51 PFAM
Pfam:7tm_1 39 288 6e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208533
AA Change: V302A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actbl2 T A 13: 111,256,255 C375S probably benign Het
Adgrg3 A G 8: 95,034,764 probably benign Het
Amn1 C T 6: 149,185,031 M44I probably benign Het
Atg2b T C 12: 105,623,430 Y1854C probably benign Het
Bcat2 T A 7: 45,587,963 N290K probably benign Het
Ccdc39 T C 3: 33,825,169 probably null Het
Cnot10 T C 9: 114,613,637 S501G probably benign Het
Col6a6 A G 9: 105,767,198 probably null Het
Coq2 A C 5: 100,660,250 C228W probably damaging Het
Cpt2 A T 4: 107,906,974 M531K possibly damaging Het
Dennd1a A G 2: 38,021,363 L204P probably damaging Het
Dirc2 T A 16: 35,734,068 probably null Het
Dock9 C T 14: 121,597,663 V1305M probably benign Het
Dusp16 A G 6: 134,725,925 I201T probably damaging Het
Esco2 T C 14: 65,827,181 D370G probably benign Het
Fbxl4 T C 4: 22,377,037 S158P probably damaging Het
Fut10 A G 8: 31,236,204 H329R possibly damaging Het
Gm10436 T C 12: 88,176,258 T392A probably damaging Het
Gpr3 A G 4: 133,211,329 W11R probably damaging Het
H2-M3 T A 17: 37,270,729 I94N probably damaging Het
Krt7 T C 15: 101,412,643 I57T probably damaging Het
Ltc4s T C 11: 50,238,546 probably benign Het
Ms4a6b A T 19: 11,523,940 T105S probably damaging Het
Muc6 T C 7: 141,648,658 H592R probably benign Het
Ncam1 T C 9: 49,565,003 E262G probably benign Het
Olfr1265 T A 2: 90,037,747 I276K possibly damaging Het
Plxnb1 T A 9: 109,114,412 S1908T probably damaging Het
Polg2 A T 11: 106,775,593 M242K probably benign Het
Polr3g T C 13: 81,694,444 T151A unknown Het
Psmb8 T C 17: 34,200,212 L160P possibly damaging Het
Rab5b G A 10: 128,681,391 A176V possibly damaging Het
Rreb1 T C 13: 37,931,034 C790R probably damaging Het
Rufy3 A G 5: 88,640,617 T506A probably benign Het
Samd11 T C 4: 156,255,183 probably benign Het
Slc12a2 T C 18: 57,896,378 F279L possibly damaging Het
Son TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCAGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,295 probably benign Het
Srgn C T 10: 62,494,978 W116* probably null Het
Svil A G 18: 5,099,663 E1733G probably damaging Het
Tbc1d22a C T 15: 86,235,541 P49S probably benign Het
Tbc1d9 A T 8: 83,242,553 K490M probably damaging Het
Tcte1 A G 17: 45,534,989 N173S probably benign Het
Tmco6 C T 18: 36,735,393 R31W probably damaging Het
Ttn C A 2: 76,899,681 A5155S unknown Het
Tyro3 T C 2: 119,816,906 Y839H probably damaging Het
Zc3h12d A G 10: 7,867,576 D370G probably benign Het
Zc3h7b T C 15: 81,780,602 L554P probably damaging Het
Zfp352 C T 4: 90,224,777 P385S probably benign Het
Other mutations in Olfr1462
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Olfr1462 APN 19 13191234 missense possibly damaging 0.60
IGL01999:Olfr1462 APN 19 13191560 missense probably damaging 0.99
IGL02326:Olfr1462 APN 19 13191415 nonsense probably null
IGL03381:Olfr1462 APN 19 13191405 missense probably damaging 0.98
R1184:Olfr1462 UTSW 19 13191375 missense probably damaging 0.99
R1434:Olfr1462 UTSW 19 13191298 missense probably benign 0.19
R2161:Olfr1462 UTSW 19 13191309 missense probably damaging 0.99
R2399:Olfr1462 UTSW 19 13191345 missense probably benign 0.02
R4583:Olfr1462 UTSW 19 13190698 missense probably damaging 1.00
R5937:Olfr1462 UTSW 19 13191311 missense probably damaging 1.00
R7164:Olfr1462 UTSW 19 13190906 missense probably benign 0.00
R7270:Olfr1462 UTSW 19 13191404 missense possibly damaging 0.90
R7649:Olfr1462 UTSW 19 13190772 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CGCAAAGCTCTCTCCACTTG -3'
(R):5'- GGTTTCACCATTTTGAGCAAGATG -3'

Sequencing Primer
(F):5'- TGTACCTCACACTTTACAGCTG -3'
(R):5'- GCAAGATGTATCCTTTTTAGCAGCC -3'
Posted On2019-10-24