Incidental Mutation 'R7646:Setx'
ID590517
Institutional Source Beutler Lab
Gene Symbol Setx
Ensembl Gene ENSMUSG00000043535
Gene Namesenataxin
SynonymsA930037J23Rik, Als4
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7646 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location29124181-29182471 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29177549 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 2388 (I2388V)
Ref Sequence ENSEMBL: ENSMUSP00000051492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061578]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061578
AA Change: I2388V

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000051492
Gene: ENSMUSG00000043535
AA Change: I2388V

DomainStartEndE-ValueType
low complexity region 864 876 N/A INTRINSIC
low complexity region 1002 1020 N/A INTRINSIC
low complexity region 1058 1079 N/A INTRINSIC
low complexity region 1575 1594 N/A INTRINSIC
Pfam:AAA_11 1909 2194 1.9e-68 PFAM
Pfam:AAA_19 1924 2015 2.9e-11 PFAM
Pfam:AAA_12 2201 2402 1.1e-54 PFAM
low complexity region 2499 2516 N/A INTRINSIC
low complexity region 2576 2587 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000119176
Gene: ENSMUSG00000043535
AA Change: I316V

DomainStartEndE-ValueType
Pfam:AAA_11 1 68 5.8e-26 PFAM
Pfam:AAA_12 75 331 4.5e-54 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein named for its homology to the Sen1p protein of fungi which has RNA helicase activity encoded by a domain at the C-terminal end of the protein. The protein encoded by this gene contains a DNA/RNA helicase domain at its C-terminal end which suggests that it may be involved in both DNA and RNA processing. Mutations in this gene have been associated with ataxia-ocular apraxia-2 (AOA2) and an autosomal dominant form of juvenile amyotrophic lateral sclerosis (ALS4). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility due to arrested male meiosis and reduced female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A G 7: 120,514,714 H936R probably benign Het
Afg3l1 C A 8: 123,493,027 D431E possibly damaging Het
Agrn T C 4: 156,195,354 N120S probably damaging Het
Apob A G 12: 8,009,189 D2557G probably damaging Het
Atl2 A G 17: 79,854,607 Y359H probably damaging Het
Banp T C 8: 122,024,036 S489P possibly damaging Het
Cage1 A G 13: 38,022,847 C341R probably damaging Het
Cdh23 T C 10: 60,305,152 N3139S possibly damaging Het
Chd2 G T 7: 73,435,773 S1704R possibly damaging Het
Col4a2 T A 8: 11,445,086 F1515I probably benign Het
Crocc T A 4: 141,021,655 Q1613L probably null Het
Cttnbp2 A T 6: 18,375,940 S1533R probably damaging Het
Dlgap5 C T 14: 47,399,519 probably null Het
Dnah8 G A 17: 30,649,677 D362N probably benign Het
Elf5 G T 2: 103,439,243 K56N probably benign Het
Emsy G A 7: 98,619,353 P508S probably damaging Het
Fam135a T C 1: 24,028,623 H1055R probably benign Het
Fh1 C T 1: 175,614,913 V124I probably benign Het
Gbf1 T A 19: 46,283,672 D1610E probably damaging Het
Glp1r A G 17: 30,936,283 K415E probably benign Het
Glyr1 T C 16: 5,018,497 D496G probably damaging Het
Herc2 A G 7: 56,134,613 I1342V probably benign Het
Hoxa7 A G 6: 52,215,719 *230Q probably null Het
Ice1 A G 13: 70,589,797 V2177A possibly damaging Het
Ildr1 T A 16: 36,721,919 M271K possibly damaging Het
Lig3 T A 11: 82,783,478 N43K probably benign Het
Mcmdc2 A G 1: 9,912,135 T83A possibly damaging Het
Megf10 GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA GGCAGCAACAGCACCAGCAGCA 18: 57,293,999 probably benign Het
Mki67 A T 7: 135,696,769 S2179T possibly damaging Het
Mrpl38 G A 11: 116,132,767 S282L probably damaging Het
Ndst2 A G 14: 20,724,459 probably null Het
Nlrp4a C G 7: 26,449,562 A198G probably damaging Het
Nup98 A C 7: 102,154,035 S653A probably benign Het
Olfr1084 C A 2: 86,639,169 D180Y probably damaging Het
Olfr1120 A G 2: 87,357,758 I105V probably benign Het
Olfr116 G T 17: 37,624,404 T77K probably damaging Het
Olfr60 A G 7: 140,345,951 F13L probably damaging Het
Olfr632 G A 7: 103,938,297 A306T probably damaging Het
Pclo A T 5: 14,520,895 D98V probably damaging Het
Peg3 A T 7: 6,709,222 D1000E probably benign Het
Polr3h A G 15: 81,917,370 Y131H probably damaging Het
Rapgef6 A G 11: 54,625,954 I346V probably benign Het
Rufy1 T A 11: 50,410,609 K332M probably damaging Het
Scn1a T C 2: 66,287,758 M404V possibly damaging Het
Sept8 T A 11: 53,537,917 probably null Het
Sesn3 A G 9: 14,308,615 D100G probably damaging Het
Skint5 T A 4: 113,763,542 probably null Het
Slc25a23 C T 17: 57,059,759 probably benign Het
Slc4a7 G A 14: 14,773,348 E773K probably benign Het
Slco3a1 G A 7: 74,504,596 A76V probably damaging Het
Stradb A T 1: 58,994,408 D410V probably benign Het
Syne1 T C 10: 5,172,949 D329G probably damaging Het
Syt4 A C 18: 31,441,605 S320A possibly damaging Het
Tnfsf4 A G 1: 161,417,162 T141A possibly damaging Het
Trim34b G A 7: 104,335,352 A279T probably damaging Het
Trpm6 A T 19: 18,867,961 D1675V probably benign Het
Vmn2r24 T A 6: 123,816,210 M832K probably benign Het
Wdr90 A G 17: 25,860,130 V246A probably benign Het
Xkr6 G T 14: 63,606,974 D149Y probably damaging Het
Zfp108 A G 7: 24,261,415 Y477C probably damaging Het
Zfp37 T G 4: 62,191,295 I552L probably damaging Het
Zfp426 A T 9: 20,470,024 S556T probably damaging Het
Zfp954 G A 7: 7,115,721 L275F possibly damaging Het
Other mutations in Setx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00688:Setx APN 2 29148445 missense possibly damaging 0.50
IGL00806:Setx APN 2 29127026 missense probably damaging 1.00
IGL01346:Setx APN 2 29144809 missense probably damaging 1.00
IGL01623:Setx APN 2 29163009 missense possibly damaging 0.70
IGL02351:Setx APN 2 29146964 missense probably benign 0.45
IGL02358:Setx APN 2 29146964 missense probably benign 0.45
IGL02378:Setx APN 2 29173726 splice site probably benign
IGL02388:Setx APN 2 29173653 missense probably damaging 1.00
IGL02408:Setx APN 2 29133930 missense probably damaging 1.00
IGL02425:Setx APN 2 29148408 missense probably benign 0.00
IGL03023:Setx APN 2 29145902 missense probably benign 0.02
IGL03351:Setx APN 2 29161799 missense probably benign 0.25
Addison UTSW 2 29158905 missense probably damaging 1.00
dallas UTSW 2 29154061 frame shift probably null
Denton UTSW 2 29145060 missense possibly damaging 0.81
doggie UTSW 2 29164550 missense probably damaging 1.00
Irving UTSW 2 29139221 missense probably damaging 0.99
IGL03014:Setx UTSW 2 29139411 missense probably damaging 1.00
PIT4403001:Setx UTSW 2 29133955 missense probably damaging 1.00
R0027:Setx UTSW 2 29139221 missense probably damaging 0.99
R0031:Setx UTSW 2 29176929 missense probably benign 0.02
R0070:Setx UTSW 2 29161525 missense probably benign 0.00
R0070:Setx UTSW 2 29161525 missense probably benign 0.00
R0092:Setx UTSW 2 29146293 missense probably benign 0.00
R0193:Setx UTSW 2 29179673 missense probably benign 0.21
R0281:Setx UTSW 2 29179643 missense probably benign 0.00
R0401:Setx UTSW 2 29166289 nonsense probably null
R0413:Setx UTSW 2 29139278 missense probably damaging 1.00
R0517:Setx UTSW 2 29157133 missense probably benign 0.00
R0536:Setx UTSW 2 29158248 missense possibly damaging 0.46
R0617:Setx UTSW 2 29146807 missense possibly damaging 0.86
R1183:Setx UTSW 2 29180092 missense probably benign
R1331:Setx UTSW 2 29179686 missense probably benign
R1465:Setx UTSW 2 29140389 critical splice donor site probably null
R1465:Setx UTSW 2 29140389 critical splice donor site probably null
R1467:Setx UTSW 2 29158905 missense probably damaging 1.00
R1467:Setx UTSW 2 29158905 missense probably damaging 1.00
R1482:Setx UTSW 2 29162992 missense probably damaging 0.99
R1599:Setx UTSW 2 29140373 missense probably benign 0.04
R1663:Setx UTSW 2 29126905 missense probably damaging 1.00
R1909:Setx UTSW 2 29163009 missense possibly damaging 0.70
R2117:Setx UTSW 2 29130301 missense probably benign 0.01
R2207:Setx UTSW 2 29154061 frame shift probably null
R2221:Setx UTSW 2 29154061 frame shift probably null
R2223:Setx UTSW 2 29148537 missense possibly damaging 0.89
R2223:Setx UTSW 2 29154061 frame shift probably null
R2273:Setx UTSW 2 29154061 frame shift probably null
R2274:Setx UTSW 2 29154061 frame shift probably null
R2275:Setx UTSW 2 29154061 frame shift probably null
R2309:Setx UTSW 2 29158904 missense probably damaging 1.00
R2328:Setx UTSW 2 29154060 frame shift probably null
R2328:Setx UTSW 2 29154061 frame shift probably null
R2329:Setx UTSW 2 29154061 frame shift probably null
R2331:Setx UTSW 2 29154061 frame shift probably null
R2332:Setx UTSW 2 29154061 frame shift probably null
R2429:Setx UTSW 2 29179898 missense probably benign 0.00
R2438:Setx UTSW 2 29154061 frame shift probably null
R2439:Setx UTSW 2 29154061 frame shift probably null
R2496:Setx UTSW 2 29144801 missense probably benign 0.11
R2858:Setx UTSW 2 29154061 frame shift probably null
R2859:Setx UTSW 2 29154061 frame shift probably null
R2884:Setx UTSW 2 29148625 missense probably damaging 0.98
R2885:Setx UTSW 2 29148625 missense probably damaging 0.98
R2886:Setx UTSW 2 29148625 missense probably damaging 0.98
R2915:Setx UTSW 2 29172324 missense probably damaging 0.99
R2921:Setx UTSW 2 29154060 small deletion probably benign
R2921:Setx UTSW 2 29154061 frame shift probably null
R2923:Setx UTSW 2 29154061 frame shift probably null
R3426:Setx UTSW 2 29154061 frame shift probably null
R3609:Setx UTSW 2 29154061 frame shift probably null
R3610:Setx UTSW 2 29154061 frame shift probably null
R3731:Setx UTSW 2 29154061 frame shift probably null
R3813:Setx UTSW 2 29154061 frame shift probably null
R3835:Setx UTSW 2 29145060 missense possibly damaging 0.81
R3871:Setx UTSW 2 29145741 missense probably damaging 0.98
R4013:Setx UTSW 2 29154061 frame shift probably null
R4014:Setx UTSW 2 29154061 frame shift probably null
R4015:Setx UTSW 2 29154061 frame shift probably null
R4017:Setx UTSW 2 29154061 frame shift probably null
R4246:Setx UTSW 2 29154061 frame shift probably null
R4248:Setx UTSW 2 29154061 frame shift probably null
R4297:Setx UTSW 2 29154061 frame shift probably null
R4298:Setx UTSW 2 29154061 frame shift probably null
R4539:Setx UTSW 2 29179748 missense probably benign 0.14
R4590:Setx UTSW 2 29144809 missense probably damaging 1.00
R4632:Setx UTSW 2 29148615 missense probably benign 0.23
R4782:Setx UTSW 2 29144046 missense probably damaging 0.99
R4801:Setx UTSW 2 29146373 missense probably benign 0.14
R4802:Setx UTSW 2 29146373 missense probably benign 0.14
R4975:Setx UTSW 2 29164550 missense probably damaging 1.00
R5040:Setx UTSW 2 29139338 missense probably damaging 1.00
R5133:Setx UTSW 2 29180081 missense probably benign 0.02
R5208:Setx UTSW 2 29166367 missense possibly damaging 0.63
R5237:Setx UTSW 2 29146983 missense probably benign 0.00
R5248:Setx UTSW 2 29148418 missense probably benign 0.26
R5288:Setx UTSW 2 29134033 critical splice donor site probably null
R5385:Setx UTSW 2 29134033 critical splice donor site probably null
R5387:Setx UTSW 2 29147594 missense probably benign 0.00
R5407:Setx UTSW 2 29145474 missense probably benign 0.00
R5685:Setx UTSW 2 29171280 missense probably damaging 1.00
R6110:Setx UTSW 2 29140290 missense probably damaging 1.00
R6136:Setx UTSW 2 29148027 missense probably benign 0.01
R6310:Setx UTSW 2 29176935 missense possibly damaging 0.57
R6328:Setx UTSW 2 29174462 intron probably benign
R6358:Setx UTSW 2 29171348 missense possibly damaging 0.79
R6384:Setx UTSW 2 29173558 missense probably damaging 1.00
R6400:Setx UTSW 2 29130274 missense probably damaging 0.97
R6572:Setx UTSW 2 29173694 missense possibly damaging 0.63
R6662:Setx UTSW 2 29158114 missense probably damaging 0.97
R6898:Setx UTSW 2 29148108 missense probably benign 0.00
R7188:Setx UTSW 2 29148172 missense probably benign 0.02
R7332:Setx UTSW 2 29146626 missense probably benign 0.00
R7357:Setx UTSW 2 29130301 missense probably benign 0.01
R7556:Setx UTSW 2 29146493 missense possibly damaging 0.88
R7802:Setx UTSW 2 29147021 missense probably benign 0.02
R7810:Setx UTSW 2 29148651 missense probably benign 0.43
X0066:Setx UTSW 2 29147879 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGATCCACCAGTGACTGCTC -3'
(R):5'- AGCCAAGTAGCTGAAAGACC -3'

Sequencing Primer
(F):5'- TGTTTGAGCGTCACCACAACATG -3'
(R):5'- GACCTAACCACCTTTATTTTGTAACC -3'
Posted On2019-10-24