Incidental Mutation 'R7646:Zfp954'
ID590531
Institutional Source Beutler Lab
Gene Symbol Zfp954
Ensembl Gene ENSMUSG00000062116
Gene Namezinc finger protein 954
Synonyms5730403M16Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R7646 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location7114690-7121488 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 7115721 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 275 (L275F)
Ref Sequence ENSEMBL: ENSMUSP00000072585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056246]
Predicted Effect possibly damaging
Transcript: ENSMUST00000056246
AA Change: L275F

PolyPhen 2 Score 0.652 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000072585
Gene: ENSMUSG00000062116
AA Change: L275F

DomainStartEndE-ValueType
KRAB 42 102 4.6e-14 SMART
ZnF_C2H2 198 220 5.14e-3 SMART
ZnF_C2H2 226 248 3.21e-4 SMART
ZnF_C2H2 254 276 3.63e-3 SMART
ZnF_C2H2 282 304 7.9e-4 SMART
ZnF_C2H2 310 332 1.69e-3 SMART
ZnF_C2H2 338 360 1.26e-2 SMART
ZnF_C2H2 364 386 2.01e-5 SMART
ZnF_C2H2 392 414 1.26e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A G 7: 120,514,714 H936R probably benign Het
Afg3l1 C A 8: 123,493,027 D431E possibly damaging Het
Agrn T C 4: 156,195,354 N120S probably damaging Het
Apob A G 12: 8,009,189 D2557G probably damaging Het
Atl2 A G 17: 79,854,607 Y359H probably damaging Het
Banp T C 8: 122,024,036 S489P possibly damaging Het
Cage1 A G 13: 38,022,847 C341R probably damaging Het
Cdh23 T C 10: 60,305,152 N3139S possibly damaging Het
Chd2 G T 7: 73,435,773 S1704R possibly damaging Het
Col4a2 T A 8: 11,445,086 F1515I probably benign Het
Crocc T A 4: 141,021,655 Q1613L probably null Het
Cttnbp2 A T 6: 18,375,940 S1533R probably damaging Het
Dlgap5 C T 14: 47,399,519 probably null Het
Dnah8 G A 17: 30,649,677 D362N probably benign Het
Elf5 G T 2: 103,439,243 K56N probably benign Het
Emsy G A 7: 98,619,353 P508S probably damaging Het
Fam135a T C 1: 24,028,623 H1055R probably benign Het
Fh1 C T 1: 175,614,913 V124I probably benign Het
Gbf1 T A 19: 46,283,672 D1610E probably damaging Het
Glp1r A G 17: 30,936,283 K415E probably benign Het
Glyr1 T C 16: 5,018,497 D496G probably damaging Het
Herc2 A G 7: 56,134,613 I1342V probably benign Het
Hoxa7 A G 6: 52,215,719 *230Q probably null Het
Ice1 A G 13: 70,589,797 V2177A possibly damaging Het
Ildr1 T A 16: 36,721,919 M271K possibly damaging Het
Lig3 T A 11: 82,783,478 N43K probably benign Het
Mcmdc2 A G 1: 9,912,135 T83A possibly damaging Het
Megf10 GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA GGCAGCAACAGCACCAGCAGCA 18: 57,293,999 probably benign Het
Mki67 A T 7: 135,696,769 S2179T possibly damaging Het
Mrpl38 G A 11: 116,132,767 S282L probably damaging Het
Ndst2 A G 14: 20,724,459 probably null Het
Nlrp4a C G 7: 26,449,562 A198G probably damaging Het
Nup98 A C 7: 102,154,035 S653A probably benign Het
Olfr1084 C A 2: 86,639,169 D180Y probably damaging Het
Olfr1120 A G 2: 87,357,758 I105V probably benign Het
Olfr116 G T 17: 37,624,404 T77K probably damaging Het
Olfr60 A G 7: 140,345,951 F13L probably damaging Het
Olfr632 G A 7: 103,938,297 A306T probably damaging Het
Pclo A T 5: 14,520,895 D98V probably damaging Het
Peg3 A T 7: 6,709,222 D1000E probably benign Het
Polr3h A G 15: 81,917,370 Y131H probably damaging Het
Rapgef6 A G 11: 54,625,954 I346V probably benign Het
Rufy1 T A 11: 50,410,609 K332M probably damaging Het
Scn1a T C 2: 66,287,758 M404V possibly damaging Het
Sept8 T A 11: 53,537,917 probably null Het
Sesn3 A G 9: 14,308,615 D100G probably damaging Het
Setx A G 2: 29,177,549 I2388V possibly damaging Het
Skint5 T A 4: 113,763,542 probably null Het
Slc25a23 C T 17: 57,059,759 probably benign Het
Slc4a7 G A 14: 14,773,348 E773K probably benign Het
Slco3a1 G A 7: 74,504,596 A76V probably damaging Het
Stradb A T 1: 58,994,408 D410V probably benign Het
Syne1 T C 10: 5,172,949 D329G probably damaging Het
Syt4 A C 18: 31,441,605 S320A possibly damaging Het
Tnfsf4 A G 1: 161,417,162 T141A possibly damaging Het
Trim34b G A 7: 104,335,352 A279T probably damaging Het
Trpm6 A T 19: 18,867,961 D1675V probably benign Het
Vmn2r24 T A 6: 123,816,210 M832K probably benign Het
Wdr90 A G 17: 25,860,130 V246A probably benign Het
Xkr6 G T 14: 63,606,974 D149Y probably damaging Het
Zfp108 A G 7: 24,261,415 Y477C probably damaging Het
Zfp37 T G 4: 62,191,295 I552L probably damaging Het
Zfp426 A T 9: 20,470,024 S556T probably damaging Het
Other mutations in Zfp954
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Zfp954 APN 7 7115367 missense probably benign 0.01
IGL01696:Zfp954 APN 7 7115398 missense probably damaging 1.00
R0196:Zfp954 UTSW 7 7115391 missense probably damaging 1.00
R1723:Zfp954 UTSW 7 7115838 missense probably benign 0.04
R2112:Zfp954 UTSW 7 7115610 missense probably damaging 1.00
R2255:Zfp954 UTSW 7 7115322 missense possibly damaging 0.84
R2410:Zfp954 UTSW 7 7117809 missense probably benign 0.03
R5118:Zfp954 UTSW 7 7115715 missense probably benign 0.05
R5191:Zfp954 UTSW 7 7116023 missense probably damaging 0.96
R5832:Zfp954 UTSW 7 7115390 missense probably damaging 0.97
R5851:Zfp954 UTSW 7 7115625 nonsense probably null
R7633:Zfp954 UTSW 7 7115824 missense possibly damaging 0.72
R7710:Zfp954 UTSW 7 7117890 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAATGAGCTCGGAGTTCTGG -3'
(R):5'- GTATATCCCACCTCAATCGGC -3'

Sequencing Primer
(F):5'- GTTCTGGGTGAAATACATGCCAC -3'
(R):5'- TCGGCACTGGAAGATACACACTG -3'
Posted On2019-10-24