Incidental Mutation 'R7646:Abca16'
ID 590541
Institutional Source Beutler Lab
Gene Symbol Abca16
Ensembl Gene ENSMUSG00000051900
Gene Name ATP-binding cassette, sub-family A (ABC1), member 16
Synonyms
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_001278943.1, NM_001278944.1; MGI:2388711

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7646 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 120409647-120544813 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 120514714 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 936 (H936R)
Ref Sequence ENSEMBL: ENSMUSP00000112736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056042] [ENSMUST00000120490]
AlphaFold E9PWJ7
Predicted Effect probably benign
Transcript: ENSMUST00000056042
AA Change: H935R

PolyPhen 2 Score 0.310 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000061094
Gene: ENSMUSG00000051900
AA Change: H935R

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 26 455 2.7e-23 PFAM
AAA 537 720 2.01e-7 SMART
Pfam:ABC2_membrane_3 898 1287 4.6e-25 PFAM
low complexity region 1325 1336 N/A INTRINSIC
low complexity region 1342 1353 N/A INTRINSIC
AAA 1378 1563 4.23e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120490
AA Change: H936R

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000112736
Gene: ENSMUSG00000051900
AA Change: H936R

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 25 456 2.4e-22 PFAM
AAA 538 721 2.01e-7 SMART
Pfam:ABC2_membrane_3 899 1288 1.1e-27 PFAM
low complexity region 1326 1337 N/A INTRINSIC
low complexity region 1343 1354 N/A INTRINSIC
AAA 1379 1564 4.23e-6 SMART
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (64/64)
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l1 C A 8: 123,493,027 D431E possibly damaging Het
Agrn T C 4: 156,195,354 N120S probably damaging Het
Apob A G 12: 8,009,189 D2557G probably damaging Het
Atl2 A G 17: 79,854,607 Y359H probably damaging Het
Banp T C 8: 122,024,036 S489P possibly damaging Het
Cage1 A G 13: 38,022,847 C341R probably damaging Het
Cdh23 T C 10: 60,305,152 N3139S possibly damaging Het
Chd2 G T 7: 73,435,773 S1704R possibly damaging Het
Col4a2 T A 8: 11,445,086 F1515I probably benign Het
Crocc T A 4: 141,021,655 Q1613L probably null Het
Cttnbp2 A T 6: 18,375,940 S1533R probably damaging Het
Dlgap5 C T 14: 47,399,519 probably null Het
Dnah8 G A 17: 30,649,677 D362N probably benign Het
Elf5 G T 2: 103,439,243 K56N probably benign Het
Emsy G A 7: 98,619,353 P508S probably damaging Het
Fam135a T C 1: 24,028,623 H1055R probably benign Het
Fh1 C T 1: 175,614,913 V124I probably benign Het
Gbf1 T A 19: 46,283,672 D1610E probably damaging Het
Glp1r A G 17: 30,936,283 K415E probably benign Het
Glyr1 T C 16: 5,018,497 D496G probably damaging Het
Herc2 A G 7: 56,134,613 I1342V probably benign Het
Hoxa7 A G 6: 52,215,719 *230Q probably null Het
Ice1 A G 13: 70,589,797 V2177A possibly damaging Het
Ildr1 T A 16: 36,721,919 M271K possibly damaging Het
Klk1b22 T G 7: 44,116,118 probably null Het
Lig3 T A 11: 82,783,478 N43K probably benign Het
Mcmdc2 A G 1: 9,912,135 T83A possibly damaging Het
Megf10 GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA GGCAGCAACAGCACCAGCAGCA 18: 57,293,999 probably benign Het
Mki67 A T 7: 135,696,769 S2179T possibly damaging Het
Mrpl38 G A 11: 116,132,767 S282L probably damaging Het
Ndst2 A G 14: 20,724,459 probably null Het
Nlrp4a C G 7: 26,449,562 A198G probably damaging Het
Nup98 A C 7: 102,154,035 S653A probably benign Het
Olfr1084 C A 2: 86,639,169 D180Y probably damaging Het
Olfr1120 A G 2: 87,357,758 I105V probably benign Het
Olfr116 G T 17: 37,624,404 T77K probably damaging Het
Olfr60 A G 7: 140,345,951 F13L probably damaging Het
Olfr632 G A 7: 103,938,297 A306T probably damaging Het
Pclo A T 5: 14,520,895 D98V probably damaging Het
Peg3 A T 7: 6,709,222 D1000E probably benign Het
Polr3h A G 15: 81,917,370 Y131H probably damaging Het
Rapgef6 A G 11: 54,625,954 I346V probably benign Het
Rufy1 T A 11: 50,410,609 K332M probably damaging Het
Scn1a T C 2: 66,287,758 M404V possibly damaging Het
Sept8 T A 11: 53,537,917 probably null Het
Sesn3 A G 9: 14,308,615 D100G probably damaging Het
Setx A G 2: 29,177,549 I2388V possibly damaging Het
Skint5 T A 4: 113,763,542 probably null Het
Slc25a23 C T 17: 57,059,759 probably benign Het
Slc4a7 G A 14: 14,773,348 E773K probably benign Het
Slco3a1 G A 7: 74,504,596 A76V probably damaging Het
Stradb A T 1: 58,994,408 D410V probably benign Het
Syne1 T C 10: 5,172,949 D329G probably damaging Het
Syt4 A C 18: 31,441,605 S320A possibly damaging Het
Tnfsf4 A G 1: 161,417,162 T141A possibly damaging Het
Trim34b G A 7: 104,335,352 A279T probably damaging Het
Trpm6 A T 19: 18,867,961 D1675V probably benign Het
Vmn2r24 T A 6: 123,816,210 M832K probably benign Het
Wdr90 A G 17: 25,860,130 V246A probably benign Het
Xkr6 G T 14: 63,606,974 D149Y probably damaging Het
Zfp108 A G 7: 24,261,415 Y477C probably damaging Het
Zfp37 T G 4: 62,191,295 I552L probably damaging Het
Zfp426 A T 9: 20,470,024 S556T probably damaging Het
Zfp954 G A 7: 7,115,721 L275F possibly damaging Het
Other mutations in Abca16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Abca16 APN 7 120423759 missense probably benign 0.08
IGL00590:Abca16 APN 7 120423815 missense probably damaging 1.00
IGL01320:Abca16 APN 7 120439199 missense probably damaging 1.00
IGL01322:Abca16 APN 7 120439199 missense probably damaging 1.00
IGL01613:Abca16 APN 7 120541277 missense probably benign 0.03
IGL01774:Abca16 APN 7 120477835 missense probably damaging 1.00
IGL01774:Abca16 APN 7 120421801 splice site probably benign
IGL01797:Abca16 APN 7 120514537 missense probably benign 0.15
IGL02406:Abca16 APN 7 120540602 missense probably damaging 1.00
IGL02437:Abca16 APN 7 120533729 missense probably benign 0.00
IGL02541:Abca16 APN 7 120514658 missense possibly damaging 0.91
IGL02576:Abca16 APN 7 120433455 missense probably benign 0.05
IGL02578:Abca16 APN 7 120423956 critical splice donor site probably null
IGL03156:Abca16 APN 7 120423851 missense possibly damaging 0.69
IGL03381:Abca16 APN 7 120527818 missense probably benign 0.12
PIT4802001:Abca16 UTSW 7 120540128 missense probably benign 0.31
R0024:Abca16 UTSW 7 120433385 missense probably damaging 1.00
R0026:Abca16 UTSW 7 120477923 splice site probably benign
R0026:Abca16 UTSW 7 120477923 splice site probably benign
R0123:Abca16 UTSW 7 120540155 missense probably damaging 1.00
R0134:Abca16 UTSW 7 120540155 missense probably damaging 1.00
R0225:Abca16 UTSW 7 120540155 missense probably damaging 1.00
R0346:Abca16 UTSW 7 120435932 missense probably damaging 1.00
R0355:Abca16 UTSW 7 120423798 missense possibly damaging 0.68
R0358:Abca16 UTSW 7 120544716 missense probably benign 0.01
R0525:Abca16 UTSW 7 120465810 nonsense probably null
R0617:Abca16 UTSW 7 120433611 splice site probably benign
R0625:Abca16 UTSW 7 120435893 missense probably damaging 1.00
R0835:Abca16 UTSW 7 120465784 missense probably benign 0.42
R1445:Abca16 UTSW 7 120520033 missense probably benign 0.41
R1535:Abca16 UTSW 7 120540705 missense probably benign 0.30
R1567:Abca16 UTSW 7 120431129 missense probably benign 0.08
R1694:Abca16 UTSW 7 120520084 missense probably damaging 1.00
R1860:Abca16 UTSW 7 120534763 missense probably benign 0.02
R1876:Abca16 UTSW 7 120433385 missense probably damaging 1.00
R1913:Abca16 UTSW 7 120541240 missense probably benign 0.04
R1940:Abca16 UTSW 7 120433609 splice site probably benign
R2042:Abca16 UTSW 7 120544718 missense probably benign
R2115:Abca16 UTSW 7 120540645 missense probably damaging 1.00
R2122:Abca16 UTSW 7 120519961 missense probably damaging 1.00
R2265:Abca16 UTSW 7 120431160 missense probably benign 0.03
R2267:Abca16 UTSW 7 120431160 missense probably benign 0.03
R2269:Abca16 UTSW 7 120431160 missense probably benign 0.03
R2993:Abca16 UTSW 7 120535161 missense probably damaging 1.00
R3055:Abca16 UTSW 7 120435851 missense probably benign 0.05
R3956:Abca16 UTSW 7 120527752 missense probably damaging 0.96
R4114:Abca16 UTSW 7 120527067 missense probably benign 0.06
R4441:Abca16 UTSW 7 120527801 missense probably benign 0.04
R4601:Abca16 UTSW 7 120436697 missense probably damaging 0.98
R4706:Abca16 UTSW 7 120465765 missense probably damaging 1.00
R4807:Abca16 UTSW 7 120540609 missense probably damaging 1.00
R4824:Abca16 UTSW 7 120475479 missense possibly damaging 0.86
R4937:Abca16 UTSW 7 120527086 missense probably damaging 0.98
R5152:Abca16 UTSW 7 120540623 missense probably benign 0.02
R5257:Abca16 UTSW 7 120436769 critical splice donor site probably null
R5258:Abca16 UTSW 7 120436769 critical splice donor site probably null
R5330:Abca16 UTSW 7 120503377 missense probably benign 0.15
R5388:Abca16 UTSW 7 120540746 critical splice donor site probably null
R5590:Abca16 UTSW 7 120544772 missense probably damaging 0.98
R5810:Abca16 UTSW 7 120435932 missense probably damaging 1.00
R6030:Abca16 UTSW 7 120533798 missense probably benign
R6030:Abca16 UTSW 7 120533798 missense probably benign
R6161:Abca16 UTSW 7 120540711 missense probably damaging 1.00
R6313:Abca16 UTSW 7 120527121 missense probably damaging 1.00
R6485:Abca16 UTSW 7 120427167 nonsense probably null
R6527:Abca16 UTSW 7 120477772 missense possibly damaging 0.95
R6772:Abca16 UTSW 7 120527053 missense probably damaging 1.00
R6885:Abca16 UTSW 7 120520109 missense probably benign 0.07
R6899:Abca16 UTSW 7 120527041 missense probably damaging 1.00
R6941:Abca16 UTSW 7 120541147 missense probably damaging 1.00
R6990:Abca16 UTSW 7 120527727 missense probably benign 0.00
R7059:Abca16 UTSW 7 120421748 missense probably benign 0.00
R7144:Abca16 UTSW 7 120433573 missense possibly damaging 0.89
R7146:Abca16 UTSW 7 120527751 missense possibly damaging 0.46
R7193:Abca16 UTSW 7 120427186 missense probably damaging 1.00
R7308:Abca16 UTSW 7 120423770 missense probably benign 0.01
R7449:Abca16 UTSW 7 120435908 missense possibly damaging 0.95
R7571:Abca16 UTSW 7 120519988 missense probably benign 0.11
R7617:Abca16 UTSW 7 120503471 nonsense probably null
R7750:Abca16 UTSW 7 120514705 missense probably benign 0.09
R7763:Abca16 UTSW 7 120514602 missense probably damaging 1.00
R7840:Abca16 UTSW 7 120475466 missense probably benign 0.00
R7946:Abca16 UTSW 7 120527175 missense probably benign 0.01
R8018:Abca16 UTSW 7 120533643 missense probably benign 0.04
R8170:Abca16 UTSW 7 120465782 missense probably damaging 1.00
R8413:Abca16 UTSW 7 120423900 missense probably benign 0.06
R8461:Abca16 UTSW 7 120436695 missense possibly damaging 0.95
R8858:Abca16 UTSW 7 120453104 missense probably benign
R8881:Abca16 UTSW 7 120475571 missense probably benign 0.18
R9272:Abca16 UTSW 7 120477770 missense probably benign 0.13
R9303:Abca16 UTSW 7 120527766 missense probably benign 0.25
R9305:Abca16 UTSW 7 120527766 missense probably benign 0.25
R9320:Abca16 UTSW 7 120540097 missense probably damaging 0.98
R9413:Abca16 UTSW 7 120527199 missense probably benign 0.01
RF020:Abca16 UTSW 7 120533657 missense possibly damaging 0.90
X0066:Abca16 UTSW 7 120503386 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGTTCCACTTTACCGCCAG -3'
(R):5'- TAAGATACTGGTAACTGGTGGGATG -3'

Sequencing Primer
(F):5'- ACCGCCAGCAATTCTATTCC -3'
(R):5'- CCATTGCAAGTGATAAGTAGGTC -3'
Posted On 2019-10-24