Mutagenetix > Incidental Mutations

Incidental Mutation 'R7646:Cdh23'

590550

Institutional Source

Beutler Lab

Gene Symbol

Cdh23

Ensembl Gene

ENSMUSG00000012819

Gene Name

cadherin 23 (otocadherin)

Synonyms

nmf252, bob, ahl, mdfw, 4930542A03Rik, sals, nmf112, nmf181, USH1D

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.673) question?

Stock #

R7646 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

60302748-60696490 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 60305152 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 3139 (N3139S)

Ref Sequence

ENSEMBL: ENSMUSP00000101101 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004316] [ENSMUST00000073242] [ENSMUST00000105461] [ENSMUST00000105462] [ENSMUST00000105463] [ENSMUST00000105464] [ENSMUST00000105465] [ENSMUST00000165878] [ENSMUST00000177779] [ENSMUST00000179238]

Predicted Effect

probably benign
Transcript: ENSMUST00000004316

SMART Domains

Protein: ENSMUSP00000004316
Gene: ENSMUSG00000004207

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
SAPA	21	54	1.4e-18	SMART
SapB	61	138	1.87e-27	SMART
SapB	195	272	1.2e-16	SMART
SapB	314	389	2.07e-20	SMART
low complexity region	412	430	N/A	INTRINSIC
SapB	439	514	3.84e-24	SMART
SAPA	523	556	3.19e-22	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000073242
AA Change: N3138S

PolyPhen 2 Score 0.570 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000072973
Gene: ENSMUSG00000012819
AA Change: N3138S

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	55	130	5.15e-13	SMART
CA	154	234	3.19e-18	SMART
CA	258	346	2.03e-11	SMART
CA	371	458	8.11e-11	SMART
CA	482	559	1.04e-22	SMART
CA	583	669	3.55e-25	SMART
CA	693	776	2.04e-25	SMART
CA	800	888	5.03e-16	SMART
CA	912	993	1.05e-27	SMART
CA	1017	1100	1.99e-19	SMART
CA	1124	1206	6.94e-19	SMART
CA	1231	1311	1.99e-19	SMART
CA	1335	1415	1.21e-18	SMART
CA	1440	1524	2.38e-26	SMART
CA	1549	1631	6.27e-26	SMART
CA	1656	1741	6.99e-24	SMART
CA	1765	1848	3.49e-24	SMART
CA	1872	1956	2.78e-18	SMART
CA	1984	2066	5.6e-14	SMART
CA	2090	2171	2.59e-27	SMART
CA	2195	2290	2.87e-11	SMART
CA	2317	2399	1.01e-20	SMART
CA	2423	2506	1.09e-25	SMART
CA	2530	2608	7.91e-23	SMART
CA	2634	2719	1.06e-23	SMART
CA	2750	2843	2e-10	SMART
Blast:CA	2867	2956	4e-51	BLAST
transmembrane domain	3067	3089	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105461
AA Change: N3139S

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000101101
Gene: ENSMUSG00000012819
AA Change: N3139S

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	55	130	5.15e-13	SMART
CA	154	234	3.19e-18	SMART
CA	258	346	2.03e-11	SMART
CA	371	458	1.25e-11	SMART
CA	482	559	1.04e-22	SMART
CA	583	669	3.55e-25	SMART
CA	693	776	2.04e-25	SMART
CA	800	888	5.03e-16	SMART
CA	912	993	1.05e-27	SMART
CA	1017	1100	1.99e-19	SMART
CA	1124	1206	6.94e-19	SMART
CA	1231	1311	1.99e-19	SMART
CA	1335	1416	5.26e-19	SMART
CA	1441	1525	2.38e-26	SMART
CA	1550	1632	6.27e-26	SMART
CA	1657	1742	6.99e-24	SMART
CA	1766	1849	3.49e-24	SMART
CA	1873	1957	2.78e-18	SMART
CA	1985	2067	5.6e-14	SMART
CA	2091	2172	2.59e-27	SMART
CA	2196	2291	2.87e-11	SMART
CA	2318	2400	1.01e-20	SMART
CA	2424	2507	1.09e-25	SMART
CA	2531	2609	7.91e-23	SMART
CA	2635	2720	1.06e-23	SMART
CA	2751	2844	2e-10	SMART
Blast:CA	2868	2957	4e-51	BLAST
transmembrane domain	3068	3090	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000105462
AA Change: N3141S

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000101102
Gene: ENSMUSG00000012819
AA Change: N3141S

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	55	130	5.15e-13	SMART
CA	154	234	3.19e-18	SMART
CA	261	349	2.03e-11	SMART
CA	374	461	8.11e-11	SMART
CA	485	562	1.04e-22	SMART
CA	586	672	3.55e-25	SMART
CA	696	779	2.04e-25	SMART
CA	803	891	5.03e-16	SMART
CA	915	996	1.05e-27	SMART
CA	1020	1103	1.99e-19	SMART
CA	1127	1209	6.94e-19	SMART
CA	1234	1314	1.99e-19	SMART
CA	1338	1418	1.21e-18	SMART
CA	1443	1527	2.38e-26	SMART
CA	1552	1634	6.27e-26	SMART
CA	1659	1744	6.99e-24	SMART
CA	1768	1851	3.49e-24	SMART
CA	1875	1959	2.78e-18	SMART
CA	1987	2069	5.6e-14	SMART
CA	2093	2174	2.59e-27	SMART
CA	2198	2293	2.87e-11	SMART
CA	2320	2402	1.01e-20	SMART
CA	2426	2509	1.09e-25	SMART
CA	2533	2611	7.91e-23	SMART
CA	2637	2722	1.06e-23	SMART
CA	2753	2846	2e-10	SMART
Blast:CA	2870	2959	4e-51	BLAST
transmembrane domain	3070	3092	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105463
AA Change: N3139S

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000101103
Gene: ENSMUSG00000012819
AA Change: N3139S

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	55	130	5.15e-13	SMART
CA	154	234	3.19e-18	SMART
CA	258	346	2.03e-11	SMART
CA	371	458	1.25e-11	SMART
CA	482	559	1.04e-22	SMART
CA	583	669	3.55e-25	SMART
CA	693	776	2.04e-25	SMART
CA	800	888	5.03e-16	SMART
CA	912	993	1.05e-27	SMART
CA	1017	1100	1.99e-19	SMART
CA	1124	1206	6.94e-19	SMART
CA	1231	1311	1.99e-19	SMART
CA	1335	1416	5.26e-19	SMART
CA	1441	1525	2.38e-26	SMART
CA	1550	1632	6.27e-26	SMART
CA	1657	1742	6.99e-24	SMART
CA	1766	1849	3.49e-24	SMART
CA	1873	1957	2.78e-18	SMART
CA	1985	2067	5.6e-14	SMART
CA	2091	2172	2.59e-27	SMART
CA	2196	2291	2.87e-11	SMART
CA	2318	2400	1.01e-20	SMART
CA	2424	2507	1.09e-25	SMART
CA	2531	2609	7.91e-23	SMART
CA	2635	2720	1.06e-23	SMART
CA	2751	2844	2e-10	SMART
Blast:CA	2868	2957	4e-51	BLAST
transmembrane domain	3068	3090	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105464
AA Change: N3137S

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000101104
Gene: ENSMUSG00000012819
AA Change: N3137S

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	55	130	5.15e-13	SMART
CA	154	234	3.19e-18	SMART
CA	258	346	2.03e-11	SMART
CA	371	456	3.58e-12	SMART
CA	480	557	1.04e-22	SMART
CA	581	667	3.55e-25	SMART
CA	691	774	2.04e-25	SMART
CA	798	886	5.03e-16	SMART
CA	910	991	1.05e-27	SMART
CA	1015	1098	1.99e-19	SMART
CA	1122	1204	6.94e-19	SMART
CA	1229	1309	1.99e-19	SMART
CA	1333	1414	5.26e-19	SMART
CA	1439	1523	2.38e-26	SMART
CA	1548	1630	6.27e-26	SMART
CA	1655	1740	6.99e-24	SMART
CA	1764	1847	3.49e-24	SMART
CA	1871	1955	2.78e-18	SMART
CA	1983	2065	5.6e-14	SMART
CA	2089	2170	2.59e-27	SMART
CA	2194	2289	2.87e-11	SMART
CA	2316	2398	1.01e-20	SMART
CA	2422	2505	1.09e-25	SMART
CA	2529	2607	7.91e-23	SMART
CA	2633	2718	1.06e-23	SMART
CA	2749	2842	2e-10	SMART
Blast:CA	2866	2955	3e-51	BLAST
transmembrane domain	3066	3088	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000105465

SMART Domains

Protein: ENSMUSP00000101105
Gene: ENSMUSG00000004207

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
SAPA	21	54	1.4e-18	SMART
SapB	61	138	1.87e-27	SMART
SapB	195	270	2.76e-16	SMART
SapB	312	387	2.07e-20	SMART
low complexity region	410	428	N/A	INTRINSIC
SapB	437	512	3.84e-24	SMART
SAPA	521	554	3.19e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000165878

SMART Domains

Protein: ENSMUSP00000126407
Gene: ENSMUSG00000004207

Domain	Start	End	E-Value	Type
SAPA	18	51	1.4e-18	SMART
SapB	58	135	1.87e-27	SMART
SapB	192	267	2.76e-16	SMART
SapB	309	384	2.07e-20	SMART
low complexity region	407	425	N/A	INTRINSIC
SapB	434	509	3.84e-24	SMART
SAPA	518	551	3.19e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000177779

SMART Domains

Protein: ENSMUSP00000137286
Gene: ENSMUSG00000004207

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
SAPA	21	54	1.4e-18	SMART
SapB	61	138	1.87e-27	SMART
SapB	195	273	2.37e-15	SMART
SapB	315	390	2.07e-20	SMART
low complexity region	413	431	N/A	INTRINSIC
SapB	440	515	3.84e-24	SMART
SAPA	524	557	3.19e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000179238

SMART Domains

Protein: ENSMUSP00000137476
Gene: ENSMUSG00000004207

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
SAPA	21	54	1.4e-18	SMART
SapB	61	138	1.87e-27	SMART
SapB	195	273	8.5e-17	SMART
SapB	315	390	2.07e-20	SMART
low complexity region	413	431	N/A	INTRINSIC
SapB	440	515	3.84e-24	SMART
SAPA	524	557	3.19e-22	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily, whose genes encode calcium dependent cell-cell adhesion glycoproteins. The encoded protein is thought to be involved in stereocilia organization and hair bundle formation. The gene is located in a region containing the human deafness loci DFNB12 and USH1D. Usher syndrome 1D and nonsyndromic autosomal recessive deafness DFNB12 are caused by allelic mutations of this cadherin-like gene. Upregulation of this gene may also be associated with breast cancer. Alternative splice variants encoding different isoforms have been described. [provided by RefSeq, May 2013]
PHENOTYPE: Mutant mice exhibit circling behavior, tilting of the head and are deaf. Mice homozygous for a targeted knock-out exhibit abnormal outer hair cells morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca16	A	G	7: 120,514,714	H936R	probably benign	Het
Afg3l1	C	A	8: 123,493,027	D431E	possibly damaging	Het
Agrn	T	C	4: 156,195,354	N120S	probably damaging	Het
Apob	A	G	12: 8,009,189	D2557G	probably damaging	Het
Atl2	A	G	17: 79,854,607	Y359H	probably damaging	Het
Banp	T	C	8: 122,024,036	S489P	possibly damaging	Het
Cage1	A	G	13: 38,022,847	C341R	probably damaging	Het
Chd2	G	T	7: 73,435,773	S1704R	possibly damaging	Het
Col4a2	T	A	8: 11,445,086	F1515I	probably benign	Het
Crocc	T	A	4: 141,021,655	Q1613L	probably null	Het
Cttnbp2	A	T	6: 18,375,940	S1533R	probably damaging	Het
Dlgap5	C	T	14: 47,399,519		probably null	Het
Dnah8	G	A	17: 30,649,677	D362N	probably benign	Het
Elf5	G	T	2: 103,439,243	K56N	probably benign	Het
Emsy	G	A	7: 98,619,353	P508S	probably damaging	Het
Fam135a	T	C	1: 24,028,623	H1055R	probably benign	Het
Fh1	C	T	1: 175,614,913	V124I	probably benign	Het
Gbf1	T	A	19: 46,283,672	D1610E	probably damaging	Het
Glp1r	A	G	17: 30,936,283	K415E	probably benign	Het
Glyr1	T	C	16: 5,018,497	D496G	probably damaging	Het
Herc2	A	G	7: 56,134,613	I1342V	probably benign	Het
Hoxa7	A	G	6: 52,215,719	*230Q	probably null	Het
Ice1	A	G	13: 70,589,797	V2177A	possibly damaging	Het
Ildr1	T	A	16: 36,721,919	M271K	possibly damaging	Het
Lig3	T	A	11: 82,783,478	N43K	probably benign	Het
Mcmdc2	A	G	1: 9,912,135	T83A	possibly damaging	Het
Megf10	GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA	GGCAGCAACAGCACCAGCAGCA	18: 57,293,999		probably benign	Het
Mki67	A	T	7: 135,696,769	S2179T	possibly damaging	Het
Mrpl38	G	A	11: 116,132,767	S282L	probably damaging	Het
Ndst2	A	G	14: 20,724,459		probably null	Het
Nlrp4a	C	G	7: 26,449,562	A198G	probably damaging	Het
Nup98	A	C	7: 102,154,035	S653A	probably benign	Het
Olfr1084	C	A	2: 86,639,169	D180Y	probably damaging	Het
Olfr1120	A	G	2: 87,357,758	I105V	probably benign	Het
Olfr116	G	T	17: 37,624,404	T77K	probably damaging	Het
Olfr60	A	G	7: 140,345,951	F13L	probably damaging	Het
Olfr632	G	A	7: 103,938,297	A306T	probably damaging	Het
Pclo	A	T	5: 14,520,895	D98V	probably damaging	Het
Peg3	A	T	7: 6,709,222	D1000E	probably benign	Het
Polr3h	A	G	15: 81,917,370	Y131H	probably damaging	Het
Rapgef6	A	G	11: 54,625,954	I346V	probably benign	Het
Rufy1	T	A	11: 50,410,609	K332M	probably damaging	Het
Scn1a	T	C	2: 66,287,758	M404V	possibly damaging	Het
Sept8	T	A	11: 53,537,917		probably null	Het
Sesn3	A	G	9: 14,308,615	D100G	probably damaging	Het
Setx	A	G	2: 29,177,549	I2388V	possibly damaging	Het
Skint5	T	A	4: 113,763,542		probably null	Het
Slc25a23	C	T	17: 57,059,759		probably benign	Het
Slc4a7	G	A	14: 14,773,348	E773K	probably benign	Het
Slco3a1	G	A	7: 74,504,596	A76V	probably damaging	Het
Stradb	A	T	1: 58,994,408	D410V	probably benign	Het
Syne1	T	C	10: 5,172,949	D329G	probably damaging	Het
Syt4	A	C	18: 31,441,605	S320A	possibly damaging	Het
Tnfsf4	A	G	1: 161,417,162	T141A	possibly damaging	Het
Trim34b	G	A	7: 104,335,352	A279T	probably damaging	Het
Trpm6	A	T	19: 18,867,961	D1675V	probably benign	Het
Vmn2r24	T	A	6: 123,816,210	M832K	probably benign	Het
Wdr90	A	G	17: 25,860,130	V246A	probably benign	Het
Xkr6	G	T	14: 63,606,974	D149Y	probably damaging	Het
Zfp108	A	G	7: 24,261,415	Y477C	probably damaging	Het
Zfp37	T	G	4: 62,191,295	I552L	probably damaging	Het
Zfp426	A	T	9: 20,470,024	S556T	probably damaging	Het
Zfp954	G	A	7: 7,115,721	L275F	possibly damaging	Het

Other mutations in Cdh23

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Cdh23	APN	10	60523548	missense	probably benign	0.03
IGL00429:Cdh23	APN	10	60421141	missense	probably damaging	0.97
IGL01014:Cdh23	APN	10	60307522	missense	probably damaging	0.99
IGL01284:Cdh23	APN	10	60466097	missense	possibly damaging	0.95
IGL01305:Cdh23	APN	10	60312624	missense	probably damaging	1.00
IGL01367:Cdh23	APN	10	60310787	missense	probably damaging	1.00
IGL01396:Cdh23	APN	10	60385069	missense	possibly damaging	0.93
IGL01412:Cdh23	APN	10	60314694	missense	probably damaging	1.00
IGL01461:Cdh23	APN	10	60409147	missense	possibly damaging	0.53
IGL01469:Cdh23	APN	10	60597725	missense	probably benign	0.03
IGL01695:Cdh23	APN	10	60331833	missense	probably benign	0.20
IGL01734:Cdh23	APN	10	60303513	missense	probably benign
IGL01767:Cdh23	APN	10	60315724	missense	probably damaging	1.00
IGL01796:Cdh23	APN	10	60311137	missense	probably benign	0.31
IGL01843:Cdh23	APN	10	60419819	splice site	probably null
IGL02025:Cdh23	APN	10	60385143	missense	probably damaging	1.00
IGL02071:Cdh23	APN	10	60523560	missense	possibly damaging	0.93
IGL02160:Cdh23	APN	10	60597765	splice site	probably benign
IGL02175:Cdh23	APN	10	60331308	missense	possibly damaging	0.92
IGL02220:Cdh23	APN	10	60305124	missense	probably damaging	1.00
IGL02302:Cdh23	APN	10	60323523	missense	possibly damaging	0.87
IGL02331:Cdh23	APN	10	60465543	missense	probably damaging	0.99
IGL02452:Cdh23	APN	10	60317942	missense	probably damaging	0.99
IGL02499:Cdh23	APN	10	60385179	missense	probably damaging	1.00
IGL02548:Cdh23	APN	10	60650122	missense	probably benign	0.37
IGL02593:Cdh23	APN	10	60465995	splice site	probably benign
IGL02626:Cdh23	APN	10	60391801	missense	probably damaging	1.00
IGL02951:Cdh23	APN	10	60311364	missense	probably damaging	1.00
IGL03145:Cdh23	APN	10	60376814	missense	probably damaging	0.99
dee_dee	UTSW	10	60308056	nonsense	probably null
hersey	UTSW	10	60308036	missense	probably damaging	1.00
ANU22:Cdh23	UTSW	10	60312624	missense	probably damaging	1.00
IGL02980:Cdh23	UTSW	10	60314620	missense	probably damaging	1.00
PIT4362001:Cdh23	UTSW	10	60465458	missense	probably benign	0.15
R0013:Cdh23	UTSW	10	60413173	missense	possibly damaging	0.90
R0045:Cdh23	UTSW	10	60530978	missense	probably damaging	1.00
R0045:Cdh23	UTSW	10	60530978	missense	probably damaging	1.00
R0082:Cdh23	UTSW	10	60312587	missense	probably damaging	1.00
R0124:Cdh23	UTSW	10	60308056	nonsense	probably null
R0172:Cdh23	UTSW	10	60319632	missense	probably damaging	1.00
R0195:Cdh23	UTSW	10	60317059	missense	probably damaging	0.99
R0365:Cdh23	UTSW	10	60379315	missense	probably damaging	0.99
R0437:Cdh23	UTSW	10	60410797	missense	probably damaging	1.00
R0486:Cdh23	UTSW	10	60386946	missense	probably damaging	1.00
R0494:Cdh23	UTSW	10	60316596	splice site	probably benign
R0545:Cdh23	UTSW	10	60331291	missense	probably benign	0.06
R0619:Cdh23	UTSW	10	60433777	missense	probably damaging	1.00
R0647:Cdh23	UTSW	10	60307902	missense	probably damaging	0.99
R0647:Cdh23	UTSW	10	60323374	nonsense	probably null
R0730:Cdh23	UTSW	10	60323714	missense	probably damaging	0.99
R0880:Cdh23	UTSW	10	60406421	missense	possibly damaging	0.51
R0942:Cdh23	UTSW	10	60410860	missense	possibly damaging	0.67
R0989:Cdh23	UTSW	10	60534510	missense	probably damaging	0.99
R1017:Cdh23	UTSW	10	60331793	missense	probably damaging	1.00
R1173:Cdh23	UTSW	10	60312392	splice site	probably benign
R1449:Cdh23	UTSW	10	60376951	missense	probably damaging	1.00
R1456:Cdh23	UTSW	10	60487120	missense	possibly damaging	0.84
R1519:Cdh23	UTSW	10	60379343	missense	possibly damaging	0.92
R1532:Cdh23	UTSW	10	60314331	missense	probably damaging	0.99
R1559:Cdh23	UTSW	10	60419699	splice site	probably benign
R1704:Cdh23	UTSW	10	60314611	missense	probably damaging	1.00
R1711:Cdh23	UTSW	10	60523536	missense	probably benign	0.07
R1760:Cdh23	UTSW	10	60326076	missense	probably damaging	1.00
R1782:Cdh23	UTSW	10	60488542	missense	probably damaging	1.00
R1791:Cdh23	UTSW	10	60391726	missense	possibly damaging	0.89
R1803:Cdh23	UTSW	10	60331281	missense	probably damaging	1.00
R1857:Cdh23	UTSW	10	60323297	missense	probably damaging	1.00
R1874:Cdh23	UTSW	10	60436818	missense	possibly damaging	0.52
R1914:Cdh23	UTSW	10	60323570	missense	probably damaging	0.99
R1958:Cdh23	UTSW	10	60410873	missense	probably benign	0.02
R1964:Cdh23	UTSW	10	60385222	missense	probably benign	0.31
R1966:Cdh23	UTSW	10	60323582	missense	probably damaging	1.00
R1981:Cdh23	UTSW	10	60378751	missense	probably damaging	1.00
R2010:Cdh23	UTSW	10	60314227	missense	probably damaging	0.99
R2036:Cdh23	UTSW	10	60466043	missense	possibly damaging	0.52
R2038:Cdh23	UTSW	10	60312587	missense	probably damaging	1.00
R2044:Cdh23	UTSW	10	60596730	missense	possibly damaging	0.72
R2111:Cdh23	UTSW	10	60305583	missense	probably damaging	0.99
R2112:Cdh23	UTSW	10	60305583	missense	probably damaging	0.99
R2211:Cdh23	UTSW	10	60466004	missense	possibly damaging	0.92
R2261:Cdh23	UTSW	10	60317128	missense	probably damaging	1.00
R2262:Cdh23	UTSW	10	60317128	missense	probably damaging	1.00
R2306:Cdh23	UTSW	10	60323445	missense	probably damaging	1.00
R2344:Cdh23	UTSW	10	60316724	missense	probably damaging	1.00
R2857:Cdh23	UTSW	10	60382653	critical splice donor site	probably null
R2858:Cdh23	UTSW	10	60382653	critical splice donor site	probably null
R2859:Cdh23	UTSW	10	60382653	critical splice donor site	probably null
R2876:Cdh23	UTSW	10	60307496	missense	probably damaging	1.00
R3034:Cdh23	UTSW	10	60409010	splice site	probably benign
R3424:Cdh23	UTSW	10	60376881	missense	possibly damaging	0.76
R3699:Cdh23	UTSW	10	60327370	critical splice donor site	probably null
R3700:Cdh23	UTSW	10	60327370	critical splice donor site	probably null
R3950:Cdh23	UTSW	10	60657326	missense	probably benign	0.04
R3951:Cdh23	UTSW	10	60657326	missense	probably benign	0.04
R3952:Cdh23	UTSW	10	60657326	missense	probably benign	0.04
R4108:Cdh23	UTSW	10	60410822	missense	possibly damaging	0.51
R4114:Cdh23	UTSW	10	60421040	splice site	probably null
R4273:Cdh23	UTSW	10	60311161	missense	possibly damaging	0.69
R4284:Cdh23	UTSW	10	60303493	missense	possibly damaging	0.91
R4334:Cdh23	UTSW	10	60385059	missense	probably damaging	0.99
R4474:Cdh23	UTSW	10	60311086	missense	probably damaging	1.00
R4532:Cdh23	UTSW	10	60534423	missense	probably benign	0.32
R4597:Cdh23	UTSW	10	60409044	missense	probably damaging	1.00
R4604:Cdh23	UTSW	10	60337666	missense	possibly damaging	0.93
R4793:Cdh23	UTSW	10	60331350	missense	probably damaging	1.00
R4816:Cdh23	UTSW	10	60409077	missense	possibly damaging	0.93
R4833:Cdh23	UTSW	10	60385038	missense	probably damaging	1.00
R4840:Cdh23	UTSW	10	60419777	missense	possibly damaging	0.53
R4857:Cdh23	UTSW	10	60391784	missense	probably damaging	1.00
R4869:Cdh23	UTSW	10	60376934	missense	probably damaging	1.00
R4894:Cdh23	UTSW	10	60337851	missense	probably benign	0.04
R4940:Cdh23	UTSW	10	60307935	missense	probably damaging	0.98
R5020:Cdh23	UTSW	10	60308032	missense	probably damaging	0.99
R5026:Cdh23	UTSW	10	60304848	missense	possibly damaging	0.88
R5081:Cdh23	UTSW	10	60436807	missense	possibly damaging	0.89
R5138:Cdh23	UTSW	10	60312282	missense	probably damaging	1.00
R5236:Cdh23	UTSW	10	60312572	missense	probably damaging	1.00
R5361:Cdh23	UTSW	10	60657265	critical splice donor site	probably null
R5384:Cdh23	UTSW	10	60337762	missense	probably damaging	0.99
R5500:Cdh23	UTSW	10	60314311	missense	probably damaging	1.00
R5512:Cdh23	UTSW	10	60534386	splice site	probably null
R5673:Cdh23	UTSW	10	60307857	missense	probably damaging	1.00
R5720:Cdh23	UTSW	10	60393023	missense	possibly damaging	0.71
R5726:Cdh23	UTSW	10	60407480	missense	probably damaging	0.98
R5732:Cdh23	UTSW	10	60331317	missense	possibly damaging	0.80
R5739:Cdh23	UTSW	10	60305609	missense	probably damaging	0.99
R5760:Cdh23	UTSW	10	60406392	missense	probably damaging	0.99
R5793:Cdh23	UTSW	10	60306128	missense	probably damaging	1.00
R5880:Cdh23	UTSW	10	60384934	missense	probably damaging	1.00
R5905:Cdh23	UTSW	10	60534535	missense	probably damaging	0.98
R5907:Cdh23	UTSW	10	60428379	missense	probably damaging	1.00
R5910:Cdh23	UTSW	10	60377821	missense	possibly damaging	0.81
R5932:Cdh23	UTSW	10	60392984	missense	probably damaging	1.00
R5996:Cdh23	UTSW	10	60413577	missense	possibly damaging	0.85
R6015:Cdh23	UTSW	10	60307982	missense	probably damaging	0.97
R6020:Cdh23	UTSW	10	60331326	missense	probably damaging	1.00
R6023:Cdh23	UTSW	10	60465542	missense	probably damaging	1.00
R6028:Cdh23	UTSW	10	60534535	missense	probably damaging	0.98
R6066:Cdh23	UTSW	10	60433758	missense	probably damaging	1.00
R6137:Cdh23	UTSW	10	60434512	missense	probably damaging	0.96
R6211:Cdh23	UTSW	10	60410821	missense	possibly damaging	0.90
R6298:Cdh23	UTSW	10	60426672	nonsense	probably null
R6302:Cdh23	UTSW	10	60305093	missense	possibly damaging	0.74
R6338:Cdh23	UTSW	10	60413151	missense	probably damaging	1.00
R6356:Cdh23	UTSW	10	60438847	missense	probably damaging	1.00
R6441:Cdh23	UTSW	10	60308036	missense	probably damaging	1.00
R6714:Cdh23	UTSW	10	60331830	missense	possibly damaging	0.62
R6760:Cdh23	UTSW	10	60306168	missense	probably damaging	1.00
R6807:Cdh23	UTSW	10	60378871	missense	possibly damaging	0.95
R6855:Cdh23	UTSW	10	60306122	missense	possibly damaging	0.66
R6937:Cdh23	UTSW	10	60487114	missense	probably damaging	1.00
R6942:Cdh23	UTSW	10	60438856	missense	possibly damaging	0.93
R6961:Cdh23	UTSW	10	60650114	missense	probably benign	0.00
R7009:Cdh23	UTSW	10	60337306	missense	probably damaging	0.99
R7010:Cdh23	UTSW	10	60530991	missense	probably benign	0.03
R7032:Cdh23	UTSW	10	60331788	missense	probably damaging	1.00
R7046:Cdh23	UTSW	10	60378751	missense	probably damaging	1.00
R7111:Cdh23	UTSW	10	60387044	missense	probably damaging	1.00
R7196:Cdh23	UTSW	10	60307980	missense	probably damaging	0.99
R7198:Cdh23	UTSW	10	60312599	missense	possibly damaging	0.91
R7223:Cdh23	UTSW	10	60331817	missense	probably damaging	1.00
R7290:Cdh23	UTSW	10	60376841	missense	probably benign
R7335:Cdh23	UTSW	10	60305116	missense	probably damaging	1.00
R7340:Cdh23	UTSW	10	60530996	missense	probably benign	0.19
R7350:Cdh23	UTSW	10	60410910	missense	probably damaging	1.00
R7366:Cdh23	UTSW	10	60315692	nonsense	probably null
R7374:Cdh23	UTSW	10	60317900	missense	probably damaging	0.99
R7455:Cdh23	UTSW	10	60306224	missense	possibly damaging	0.82
R7537:Cdh23	UTSW	10	60384945	missense	probably benign	0.17
R7573:Cdh23	UTSW	10	60323550	missense	probably benign	0.17
R7578:Cdh23	UTSW	10	60407407	missense	probably benign	0.14
R7703:Cdh23	UTSW	10	60337264	missense	probably damaging	1.00
R7763:Cdh23	UTSW	10	60312577	missense	probably damaging	1.00
R7797:Cdh23	UTSW	10	60385194	missense	probably benign	0.07
X0052:Cdh23	UTSW	10	60385134	missense	probably damaging	1.00
Z1088:Cdh23	UTSW	10	60413644	missense	probably benign	0.35

Predicted Primers

PCR Primer
(F):5'- TCACGCCCAAAAGTTCCCTG -3'
(R):5'- GGATCCTGTAACAAAAGGATATAGC -3'

Sequencing Primer
(F):5'- CTGGAGCAGGGAGGTTGACATC -3'
(R):5'- CCATAGGAGCTGTGGCAGAGTTC -3'

Posted On

2019-10-24