Incidental Mutation 'R7646:Rufy1'
ID590551
Institutional Source Beutler Lab
Gene Symbol Rufy1
Ensembl Gene ENSMUSG00000020375
Gene NameRUN and FYVE domain containing 1
SynonymsZFYVE12, 3000002E04Rik, Rabip4
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.367) question?
Stock #R7646 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location50389286-50431125 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 50410609 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Methionine at position 332 (K332M)
Ref Sequence ENSEMBL: ENSMUSP00000020643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020643]
Predicted Effect probably damaging
Transcript: ENSMUST00000020643
AA Change: K332M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020643
Gene: ENSMUSG00000020375
AA Change: K332M

DomainStartEndE-ValueType
low complexity region 15 32 N/A INTRINSIC
low complexity region 83 111 N/A INTRINSIC
RUN 211 273 1.21e-21 SMART
coiled coil region 324 384 N/A INTRINSIC
coiled coil region 409 621 N/A INTRINSIC
FYVE 638 705 1.24e-24 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a RUN domain and a FYVE-type zinc finger domain. The encoded protein binds to phosphatidylinositol-3-phosphate (PI3P) and plays a role in early endosomal trafficking, tethering and fusion through interactions with small GTPases including Rab4, Rab5 and Rab14. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A G 7: 120,514,714 H936R probably benign Het
Afg3l1 C A 8: 123,493,027 D431E possibly damaging Het
Agrn T C 4: 156,195,354 N120S probably damaging Het
Apob A G 12: 8,009,189 D2557G probably damaging Het
Atl2 A G 17: 79,854,607 Y359H probably damaging Het
Banp T C 8: 122,024,036 S489P possibly damaging Het
Cage1 A G 13: 38,022,847 C341R probably damaging Het
Cdh23 T C 10: 60,305,152 N3139S possibly damaging Het
Chd2 G T 7: 73,435,773 S1704R possibly damaging Het
Col4a2 T A 8: 11,445,086 F1515I probably benign Het
Crocc T A 4: 141,021,655 Q1613L probably null Het
Cttnbp2 A T 6: 18,375,940 S1533R probably damaging Het
Dlgap5 C T 14: 47,399,519 probably null Het
Dnah8 G A 17: 30,649,677 D362N probably benign Het
Elf5 G T 2: 103,439,243 K56N probably benign Het
Emsy G A 7: 98,619,353 P508S probably damaging Het
Fam135a T C 1: 24,028,623 H1055R probably benign Het
Fh1 C T 1: 175,614,913 V124I probably benign Het
Gbf1 T A 19: 46,283,672 D1610E probably damaging Het
Glp1r A G 17: 30,936,283 K415E probably benign Het
Glyr1 T C 16: 5,018,497 D496G probably damaging Het
Herc2 A G 7: 56,134,613 I1342V probably benign Het
Hoxa7 A G 6: 52,215,719 *230Q probably null Het
Ice1 A G 13: 70,589,797 V2177A possibly damaging Het
Ildr1 T A 16: 36,721,919 M271K possibly damaging Het
Lig3 T A 11: 82,783,478 N43K probably benign Het
Mcmdc2 A G 1: 9,912,135 T83A possibly damaging Het
Megf10 GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA GGCAGCAACAGCACCAGCAGCA 18: 57,293,999 probably benign Het
Mki67 A T 7: 135,696,769 S2179T possibly damaging Het
Mrpl38 G A 11: 116,132,767 S282L probably damaging Het
Ndst2 A G 14: 20,724,459 probably null Het
Nlrp4a C G 7: 26,449,562 A198G probably damaging Het
Nup98 A C 7: 102,154,035 S653A probably benign Het
Olfr1084 C A 2: 86,639,169 D180Y probably damaging Het
Olfr1120 A G 2: 87,357,758 I105V probably benign Het
Olfr116 G T 17: 37,624,404 T77K probably damaging Het
Olfr60 A G 7: 140,345,951 F13L probably damaging Het
Olfr632 G A 7: 103,938,297 A306T probably damaging Het
Pclo A T 5: 14,520,895 D98V probably damaging Het
Peg3 A T 7: 6,709,222 D1000E probably benign Het
Polr3h A G 15: 81,917,370 Y131H probably damaging Het
Rapgef6 A G 11: 54,625,954 I346V probably benign Het
Scn1a T C 2: 66,287,758 M404V possibly damaging Het
Sept8 T A 11: 53,537,917 probably null Het
Sesn3 A G 9: 14,308,615 D100G probably damaging Het
Setx A G 2: 29,177,549 I2388V possibly damaging Het
Skint5 T A 4: 113,763,542 probably null Het
Slc25a23 C T 17: 57,059,759 probably benign Het
Slc4a7 G A 14: 14,773,348 E773K probably benign Het
Slco3a1 G A 7: 74,504,596 A76V probably damaging Het
Stradb A T 1: 58,994,408 D410V probably benign Het
Syne1 T C 10: 5,172,949 D329G probably damaging Het
Syt4 A C 18: 31,441,605 S320A possibly damaging Het
Tnfsf4 A G 1: 161,417,162 T141A possibly damaging Het
Trim34b G A 7: 104,335,352 A279T probably damaging Het
Trpm6 A T 19: 18,867,961 D1675V probably benign Het
Vmn2r24 T A 6: 123,816,210 M832K probably benign Het
Wdr90 A G 17: 25,860,130 V246A probably benign Het
Xkr6 G T 14: 63,606,974 D149Y probably damaging Het
Zfp108 A G 7: 24,261,415 Y477C probably damaging Het
Zfp37 T G 4: 62,191,295 I552L probably damaging Het
Zfp426 A T 9: 20,470,024 S556T probably damaging Het
Zfp954 G A 7: 7,115,721 L275F possibly damaging Het
Other mutations in Rufy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01131:Rufy1 APN 11 50392023 missense probably damaging 1.00
IGL01640:Rufy1 APN 11 50390378 unclassified probably benign
IGL01829:Rufy1 APN 11 50416244 nonsense probably null
IGL02559:Rufy1 APN 11 50420483 missense probably damaging 1.00
IGL03409:Rufy1 APN 11 50406483 missense probably benign 0.00
R0053:Rufy1 UTSW 11 50401465 missense probably benign 0.10
R0053:Rufy1 UTSW 11 50401465 missense probably benign 0.10
R0193:Rufy1 UTSW 11 50389852 missense probably benign 0.12
R1028:Rufy1 UTSW 11 50414598 intron probably null
R1591:Rufy1 UTSW 11 50394928 missense probably damaging 1.00
R1818:Rufy1 UTSW 11 50414572 missense probably benign 0.43
R1952:Rufy1 UTSW 11 50406406 missense probably benign 0.01
R2228:Rufy1 UTSW 11 50397784 splice site probably null
R2982:Rufy1 UTSW 11 50419708 missense possibly damaging 0.77
R4837:Rufy1 UTSW 11 50401493 missense probably damaging 0.96
R4874:Rufy1 UTSW 11 50406450 missense possibly damaging 0.80
R4959:Rufy1 UTSW 11 50401488 missense probably benign
R4968:Rufy1 UTSW 11 50410607 missense probably benign 0.01
R5204:Rufy1 UTSW 11 50406434 missense probably damaging 1.00
R5426:Rufy1 UTSW 11 50421734 missense probably damaging 1.00
R5966:Rufy1 UTSW 11 50401488 missense probably benign
R6129:Rufy1 UTSW 11 50417248 missense probably damaging 0.99
R6930:Rufy1 UTSW 11 50398380 missense probably benign 0.05
R7073:Rufy1 UTSW 11 50404463 missense probably benign 0.05
R7462:Rufy1 UTSW 11 50407828 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GTCAGATGCACCATCCATCC -3'
(R):5'- ACACATTGAGAGTTCCTACCTCTGAG -3'

Sequencing Primer
(F):5'- CTTGTACAATGTGTGGAACCCAG -3'
(R):5'- ACCTCTGAGTTCTGAGCAGC -3'
Posted On2019-10-24