Incidental Mutation 'R7647:Cspp1'
ID590576
Institutional Source Beutler Lab
Gene Symbol Cspp1
Ensembl Gene ENSMUSG00000056763
Gene Namecentrosome and spindle pole associated protein 1
Synonyms2310020J12Rik, 4930413O22Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.469) question?
Stock #R7647 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location10037987-10136768 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10135937 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1129 (D1129G)
Ref Sequence ENSEMBL: ENSMUSP00000068804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071087] [ENSMUST00000088615] [ENSMUST00000186294] [ENSMUST00000187226]
Predicted Effect probably benign
Transcript: ENSMUST00000071087
AA Change: D1129G

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000068804
Gene: ENSMUSG00000056763
AA Change: D1129G

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
low complexity region 270 285 N/A INTRINSIC
coiled coil region 349 383 N/A INTRINSIC
low complexity region 426 447 N/A INTRINSIC
low complexity region 465 484 N/A INTRINSIC
coiled coil region 568 610 N/A INTRINSIC
Pfam:CCDC66 661 810 2e-11 PFAM
coiled coil region 866 903 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088615
SMART Domains Protein: ENSMUSP00000085986
Gene: ENSMUSG00000067851

DomainStartEndE-ValueType
Pfam:DCB 28 213 5.2e-45 PFAM
low complexity region 221 233 N/A INTRINSIC
low complexity region 291 306 N/A INTRINSIC
Pfam:Sec7_N 416 575 1.3e-52 PFAM
Blast:Sec7 588 637 6e-24 BLAST
low complexity region 661 681 N/A INTRINSIC
Sec7 692 879 1.15e-105 SMART
Blast:Sec7 897 933 6e-13 BLAST
Blast:Sec7 947 986 8e-18 BLAST
Pfam:DUF1981 1217 1300 3.6e-39 PFAM
low complexity region 1587 1602 N/A INTRINSIC
low complexity region 1777 1782 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186294
AA Change: D1074G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000139775
Gene: ENSMUSG00000056763
AA Change: D1074G

DomainStartEndE-ValueType
low complexity region 266 281 N/A INTRINSIC
coiled coil region 345 379 N/A INTRINSIC
low complexity region 422 443 N/A INTRINSIC
low complexity region 461 480 N/A INTRINSIC
SCOP:d1eq1a_ 567 748 4e-3 SMART
coiled coil region 811 848 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187226
SMART Domains Protein: ENSMUSP00000140076
Gene: ENSMUSG00000056763

DomainStartEndE-ValueType
coiled coil region 1 37 N/A INTRINSIC
coiled coil region 98 135 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosome and spindle pole associated protein. The encoded protein plays a role in cell-cycle progression and spindle organization, regulates cytokinesis, interacts with Nephrocystin 8 and is required for cilia formation. Mutations in this gene result in primary cilia abnormalities and classical Joubert syndrome. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik C A 12: 18,514,802 T22K possibly damaging Het
9530053A07Rik A G 7: 28,140,045 K428E probably benign Het
Abca7 G T 10: 80,000,822 M344I probably benign Het
Alg14 T C 3: 121,361,685 S185P probably damaging Het
Atg13 A T 2: 91,688,661 H146Q possibly damaging Het
Atmin T G 8: 116,957,922 F774V possibly damaging Het
Ccdc150 A G 1: 54,356,704 D782G probably damaging Het
Ccdc86 A G 19: 10,948,999 S79P unknown Het
Cd180 A T 13: 102,705,943 E499V probably damaging Het
Cd24a C T 10: 43,582,751 H73Y unknown Het
Cdh17 C T 4: 11,814,698 P751L probably damaging Het
Chil3 A G 3: 106,148,806 L344S possibly damaging Het
Cyth1 C A 11: 118,177,288 V288L probably benign Het
Dpysl4 T A 7: 139,099,773 Y520N possibly damaging Het
Eif4b T A 15: 102,088,694 M249K unknown Het
Enam G A 5: 88,503,025 D798N probably benign Het
Gldc A G 19: 30,118,667 V648A probably damaging Het
Gm7995 A G 14: 42,311,351 I62V possibly damaging Het
Ice1 A G 13: 70,589,797 V2177A possibly damaging Het
Kdm5a T A 6: 120,427,786 S1330T probably benign Het
Mon2 G T 10: 123,006,026 P1553Q probably benign Het
Mylk G C 16: 34,879,524 S419T probably benign Het
Nsd1 A G 13: 55,299,835 T1924A probably damaging Het
Obscn T A 11: 58,997,287 probably null Het
Olfr323 A T 11: 58,625,203 V281D probably damaging Het
Olfr651 T C 7: 104,553,686 F256L probably benign Het
Olfr782 T C 10: 129,351,457 V298A probably benign Het
Olfr806 A T 10: 129,738,201 C239S probably damaging Het
Pcsk1 A G 13: 75,132,210 D718G possibly damaging Het
Pitrm1 A T 13: 6,555,408 N158I probably damaging Het
Pkd1l1 C T 11: 8,947,296 V538M Het
Prkdc G T 16: 15,737,943 G2194C probably damaging Het
Psmc5 T C 11: 106,261,607 M150T possibly damaging Het
Rint1 T C 5: 23,800,802 Y161H probably damaging Het
Sdk2 T C 11: 113,793,737 K1966R probably damaging Het
Slc4a7 G A 14: 14,773,348 E773K probably benign Het
Sp100 A G 1: 85,692,043 K353E possibly damaging Het
Ssh1 T C 5: 113,942,958 T804A probably benign Het
Vipr1 T C 9: 121,653,839 L40P possibly damaging Het
Vmn1r7 A G 6: 57,025,270 S2P probably benign Het
Vwa8 T C 14: 78,935,229 S304P probably damaging Het
Zbed4 T C 15: 88,781,721 M664T probably damaging Het
Other mutations in Cspp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Cspp1 APN 1 10112551 unclassified probably benign
IGL01070:Cspp1 APN 1 10088145 missense probably damaging 0.99
IGL01384:Cspp1 APN 1 10116680 missense probably damaging 1.00
IGL01400:Cspp1 APN 1 10085931 missense probably damaging 0.99
IGL01893:Cspp1 APN 1 10134141 unclassified probably null
IGL01909:Cspp1 APN 1 10066661 missense probably benign 0.01
IGL02229:Cspp1 APN 1 10083556 missense probably damaging 1.00
IGL02397:Cspp1 APN 1 10108465 missense possibly damaging 0.66
IGL02983:Cspp1 APN 1 10127525 missense probably benign 0.34
IGL03352:Cspp1 APN 1 10047437 missense possibly damaging 0.93
PIT4453001:Cspp1 UTSW 1 10074872 missense possibly damaging 0.83
R0312:Cspp1 UTSW 1 10058829 splice site probably benign
R0782:Cspp1 UTSW 1 10129974 splice site probably benign
R0931:Cspp1 UTSW 1 10104286 missense probably damaging 0.98
R1499:Cspp1 UTSW 1 10088966 splice site probably null
R1553:Cspp1 UTSW 1 10085897 missense possibly damaging 0.94
R1613:Cspp1 UTSW 1 10133241 missense probably damaging 1.00
R1644:Cspp1 UTSW 1 10126438 missense probably damaging 0.99
R2042:Cspp1 UTSW 1 10112538 missense probably damaging 0.98
R2090:Cspp1 UTSW 1 10090268 missense possibly damaging 0.89
R2178:Cspp1 UTSW 1 10104246 missense possibly damaging 0.81
R2247:Cspp1 UTSW 1 10066460 missense possibly damaging 0.87
R2680:Cspp1 UTSW 1 10104305 missense probably damaging 1.00
R3803:Cspp1 UTSW 1 10126373 missense probably damaging 1.00
R4520:Cspp1 UTSW 1 10134227 missense probably benign 0.11
R4531:Cspp1 UTSW 1 10066847 intron probably benign
R4906:Cspp1 UTSW 1 10082328 missense possibly damaging 0.82
R4960:Cspp1 UTSW 1 10126463 missense probably damaging 1.00
R4973:Cspp1 UTSW 1 10126463 missense probably damaging 1.00
R4976:Cspp1 UTSW 1 10126463 missense probably damaging 1.00
R4978:Cspp1 UTSW 1 10083517 missense possibly damaging 0.66
R4979:Cspp1 UTSW 1 10126463 missense probably damaging 1.00
R4981:Cspp1 UTSW 1 10126463 missense probably damaging 1.00
R4983:Cspp1 UTSW 1 10126463 missense probably damaging 1.00
R5032:Cspp1 UTSW 1 10066519 missense probably benign 0.07
R5057:Cspp1 UTSW 1 10074961 splice site probably benign
R5081:Cspp1 UTSW 1 10047466 missense possibly damaging 0.57
R5119:Cspp1 UTSW 1 10126463 missense probably damaging 1.00
R5121:Cspp1 UTSW 1 10126463 missense probably damaging 1.00
R5146:Cspp1 UTSW 1 10074876 nonsense probably null
R5373:Cspp1 UTSW 1 10134126 missense probably damaging 1.00
R5374:Cspp1 UTSW 1 10134126 missense probably damaging 1.00
R6230:Cspp1 UTSW 1 10077197 missense probably benign 0.01
R6291:Cspp1 UTSW 1 10064334 missense probably damaging 0.97
R6382:Cspp1 UTSW 1 10083475 intron probably null
R7135:Cspp1 UTSW 1 10088936 missense possibly damaging 0.92
R7388:Cspp1 UTSW 1 10065347 nonsense probably null
R7722:Cspp1 UTSW 1 10074901 missense probably benign 0.00
R8039:Cspp1 UTSW 1 10113013 missense probably benign 0.02
Z1088:Cspp1 UTSW 1 10083546 missense possibly damaging 0.81
Z1177:Cspp1 UTSW 1 10095878 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GTGCCAGAGTCCGTGTATTC -3'
(R):5'- ATTTTAAGCATGTGCAGCAGAGAG -3'

Sequencing Primer
(F):5'- CAGGGAAAGTCAGTTGGT -3'
(R):5'- TGCCAAGTAAACGTGCCTG -3'
Posted On2019-10-24