Incidental Mutation 'R7647:Ccdc150'
ID 590577
Institutional Source Beutler Lab
Gene Symbol Ccdc150
Ensembl Gene ENSMUSG00000025983
Gene Name coiled-coil domain containing 150
Synonyms 4930511H11Rik
MMRRC Submission 045725-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.078) question?
Stock # R7647 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 54289842-54407886 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 54395863 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 782 (D782G)
Ref Sequence ENSEMBL: ENSMUSP00000027128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027128] [ENSMUST00000160472]
AlphaFold Q8CDI7
Predicted Effect probably damaging
Transcript: ENSMUST00000027128
AA Change: D782G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027128
Gene: ENSMUSG00000025983
AA Change: D782G

DomainStartEndE-ValueType
coiled coil region 160 250 N/A INTRINSIC
coiled coil region 288 314 N/A INTRINSIC
coiled coil region 418 676 N/A INTRINSIC
coiled coil region 727 952 N/A INTRINSIC
coiled coil region 985 1048 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160472
SMART Domains Protein: ENSMUSP00000125195
Gene: ENSMUSG00000025983

DomainStartEndE-ValueType
coiled coil region 160 250 N/A INTRINSIC
coiled coil region 288 314 N/A INTRINSIC
coiled coil region 418 551 N/A INTRINSIC
Meta Mutation Damage Score 0.1818 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik C A 12: 18,564,803 (GRCm39) T22K possibly damaging Het
Abca7 G T 10: 79,836,656 (GRCm39) M344I probably benign Het
Alg14 T C 3: 121,155,334 (GRCm39) S185P probably damaging Het
Atg13 A T 2: 91,519,006 (GRCm39) H146Q possibly damaging Het
Atmin T G 8: 117,684,661 (GRCm39) F774V possibly damaging Het
Ccdc86 A G 19: 10,926,363 (GRCm39) S79P unknown Het
Cd180 A T 13: 102,842,451 (GRCm39) E499V probably damaging Het
Cd24a C T 10: 43,458,747 (GRCm39) H73Y unknown Het
Cdh17 C T 4: 11,814,698 (GRCm39) P751L probably damaging Het
Chil3 A G 3: 106,056,122 (GRCm39) L344S possibly damaging Het
Cspp1 A G 1: 10,206,162 (GRCm39) D1129G probably benign Het
Cyth1 C A 11: 118,068,114 (GRCm39) V288L probably benign Het
Ddx19a A T 8: 111,703,259 (GRCm39) probably null Het
Dpysl4 T A 7: 138,679,689 (GRCm39) Y520N possibly damaging Het
Eif4b T A 15: 101,997,129 (GRCm39) M249K unknown Het
Enam G A 5: 88,650,884 (GRCm39) D798N probably benign Het
Fcgbpl1 A G 7: 27,839,470 (GRCm39) K428E probably benign Het
Gldc A G 19: 30,096,067 (GRCm39) V648A probably damaging Het
Gm7995 A G 14: 42,133,308 (GRCm39) I62V possibly damaging Het
Ice1 A G 13: 70,737,916 (GRCm39) V2177A possibly damaging Het
Kdm5a T A 6: 120,404,747 (GRCm39) S1330T probably benign Het
Mon2 G T 10: 122,841,931 (GRCm39) P1553Q probably benign Het
Mylk G C 16: 34,699,894 (GRCm39) S419T probably benign Het
Nphs1 T A 7: 30,181,390 (GRCm39) probably null Het
Nsd1 A G 13: 55,447,648 (GRCm39) T1924A probably damaging Het
Obscn T A 11: 58,888,113 (GRCm39) probably null Het
Or11l3 A T 11: 58,516,029 (GRCm39) V281D probably damaging Het
Or52h9 T C 7: 104,202,893 (GRCm39) F256L probably benign Het
Or6c213 A T 10: 129,574,070 (GRCm39) C239S probably damaging Het
Or6c6 T C 10: 129,187,326 (GRCm39) V298A probably benign Het
Pcsk1 A G 13: 75,280,329 (GRCm39) D718G possibly damaging Het
Pitrm1 A T 13: 6,605,444 (GRCm39) N158I probably damaging Het
Pkd1l1 C T 11: 8,897,296 (GRCm39) V538M Het
Prkdc G T 16: 15,555,807 (GRCm39) G2194C probably damaging Het
Psmc5 T C 11: 106,152,433 (GRCm39) M150T possibly damaging Het
Rint1 T C 5: 24,005,800 (GRCm39) Y161H probably damaging Het
Sdk2 T C 11: 113,684,563 (GRCm39) K1966R probably damaging Het
Sgcb A T 5: 73,796,720 (GRCm39) probably null Het
Slc4a7 G A 14: 14,773,348 (GRCm38) E773K probably benign Het
Sp100 A G 1: 85,619,764 (GRCm39) K353E possibly damaging Het
Ssh1 T C 5: 114,081,019 (GRCm39) T804A probably benign Het
Vipr1 T C 9: 121,482,905 (GRCm39) L40P possibly damaging Het
Vmn1r7 A G 6: 57,002,255 (GRCm39) S2P probably benign Het
Vwa8 T C 14: 79,172,669 (GRCm39) S304P probably damaging Het
Zbed4 T C 15: 88,665,924 (GRCm39) M664T probably damaging Het
Other mutations in Ccdc150
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00712:Ccdc150 APN 1 54,311,709 (GRCm39) splice site probably benign
IGL00819:Ccdc150 APN 1 54,302,732 (GRCm39) missense probably damaging 1.00
IGL01973:Ccdc150 APN 1 54,339,647 (GRCm39) splice site probably null
IGL02352:Ccdc150 APN 1 54,311,680 (GRCm39) missense probably benign 0.25
IGL02359:Ccdc150 APN 1 54,311,680 (GRCm39) missense probably benign 0.25
IGL02620:Ccdc150 APN 1 54,302,704 (GRCm39) nonsense probably null
IGL02673:Ccdc150 APN 1 54,368,149 (GRCm39) missense probably benign 0.09
IGL03148:Ccdc150 APN 1 54,317,874 (GRCm39) missense possibly damaging 0.68
IGL03185:Ccdc150 APN 1 54,339,482 (GRCm39) missense probably damaging 1.00
IGL03014:Ccdc150 UTSW 1 54,329,861 (GRCm39) missense probably damaging 0.99
R0066:Ccdc150 UTSW 1 54,395,850 (GRCm39) missense probably benign
R0066:Ccdc150 UTSW 1 54,395,850 (GRCm39) missense probably benign
R0217:Ccdc150 UTSW 1 54,339,589 (GRCm39) missense possibly damaging 0.87
R0582:Ccdc150 UTSW 1 54,368,670 (GRCm39) missense probably benign
R0687:Ccdc150 UTSW 1 54,324,790 (GRCm39) splice site probably null
R0790:Ccdc150 UTSW 1 54,316,935 (GRCm39) splice site probably benign
R1146:Ccdc150 UTSW 1 54,404,130 (GRCm39) splice site probably benign
R1288:Ccdc150 UTSW 1 54,403,617 (GRCm39) missense probably damaging 1.00
R1763:Ccdc150 UTSW 1 54,393,795 (GRCm39) missense probably benign 0.42
R1855:Ccdc150 UTSW 1 54,407,069 (GRCm39) intron probably benign
R1957:Ccdc150 UTSW 1 54,303,068 (GRCm39) missense probably benign 0.00
R2180:Ccdc150 UTSW 1 54,311,706 (GRCm39) critical splice donor site probably null
R2226:Ccdc150 UTSW 1 54,404,084 (GRCm39) missense probably null 0.11
R3054:Ccdc150 UTSW 1 54,328,001 (GRCm39) missense possibly damaging 0.51
R3055:Ccdc150 UTSW 1 54,328,001 (GRCm39) missense possibly damaging 0.51
R3056:Ccdc150 UTSW 1 54,328,001 (GRCm39) missense possibly damaging 0.51
R3409:Ccdc150 UTSW 1 54,395,932 (GRCm39) missense probably benign 0.02
R3411:Ccdc150 UTSW 1 54,395,932 (GRCm39) missense probably benign 0.02
R3812:Ccdc150 UTSW 1 54,407,469 (GRCm39) missense probably benign 0.00
R4031:Ccdc150 UTSW 1 54,317,970 (GRCm39) missense probably benign 0.31
R4356:Ccdc150 UTSW 1 54,392,213 (GRCm39) missense probably damaging 0.98
R4617:Ccdc150 UTSW 1 54,394,913 (GRCm39) missense probably benign 0.00
R4757:Ccdc150 UTSW 1 54,317,874 (GRCm39) missense possibly damaging 0.81
R4957:Ccdc150 UTSW 1 54,404,027 (GRCm39) intron probably benign
R5028:Ccdc150 UTSW 1 54,302,636 (GRCm39) missense probably benign 0.01
R5512:Ccdc150 UTSW 1 54,393,806 (GRCm39) missense probably damaging 0.96
R5757:Ccdc150 UTSW 1 54,302,779 (GRCm39) missense probably damaging 1.00
R5943:Ccdc150 UTSW 1 54,339,526 (GRCm39) missense probably benign 0.01
R5948:Ccdc150 UTSW 1 54,316,873 (GRCm39) missense possibly damaging 0.79
R6033:Ccdc150 UTSW 1 54,324,787 (GRCm39) critical splice donor site probably null
R6033:Ccdc150 UTSW 1 54,324,787 (GRCm39) critical splice donor site probably null
R6065:Ccdc150 UTSW 1 54,302,758 (GRCm39) missense possibly damaging 0.90
R6390:Ccdc150 UTSW 1 54,407,176 (GRCm39) missense probably benign 0.01
R6399:Ccdc150 UTSW 1 54,303,116 (GRCm39) splice site probably null
R6988:Ccdc150 UTSW 1 54,394,868 (GRCm39) nonsense probably null
R7248:Ccdc150 UTSW 1 54,344,057 (GRCm39) missense probably benign 0.00
R7319:Ccdc150 UTSW 1 54,302,496 (GRCm39) splice site probably null
R7322:Ccdc150 UTSW 1 54,299,125 (GRCm39) missense probably benign 0.01
R7366:Ccdc150 UTSW 1 54,339,541 (GRCm39) nonsense probably null
R7981:Ccdc150 UTSW 1 54,407,551 (GRCm39) missense probably damaging 1.00
R8002:Ccdc150 UTSW 1 54,311,656 (GRCm39) missense probably damaging 0.99
R8201:Ccdc150 UTSW 1 54,368,646 (GRCm39) missense probably benign 0.10
R8688:Ccdc150 UTSW 1 54,407,132 (GRCm39) missense probably damaging 1.00
R8719:Ccdc150 UTSW 1 54,302,668 (GRCm39) missense probably benign 0.00
R8963:Ccdc150 UTSW 1 54,311,641 (GRCm39) missense probably benign 0.14
R9178:Ccdc150 UTSW 1 54,311,644 (GRCm39) missense probably damaging 0.99
R9200:Ccdc150 UTSW 1 54,299,197 (GRCm39) missense probably damaging 1.00
R9332:Ccdc150 UTSW 1 54,316,910 (GRCm39) missense probably damaging 0.99
R9367:Ccdc150 UTSW 1 54,324,760 (GRCm39) missense probably damaging 1.00
R9416:Ccdc150 UTSW 1 54,317,990 (GRCm39) missense probably damaging 0.97
R9430:Ccdc150 UTSW 1 54,320,930 (GRCm39) missense probably damaging 1.00
R9576:Ccdc150 UTSW 1 54,407,544 (GRCm39) nonsense probably null
R9747:Ccdc150 UTSW 1 54,299,107 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AACTGCCTTCTGAGAGTGGTG -3'
(R):5'- GGATGCTTTCAGTGACCGAG -3'

Sequencing Primer
(F):5'- CCTTCTGAGAGTGGTGTTGGTGATAG -3'
(R):5'- CTTTCAGTGACCGAGAGAGATGC -3'
Posted On 2019-10-24