Incidental Mutation 'R7647:Atg13'
ID590579
Institutional Source Beutler Lab
Gene Symbol Atg13
Ensembl Gene ENSMUSG00000027244
Gene Nameautophagy related 13
SynonymsD2Ertd391e, 1110053A20Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7647 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location91674618-91710576 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 91688661 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 146 (H146Q)
Ref Sequence ENSEMBL: ENSMUSP00000076081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028678] [ENSMUST00000076803]
Predicted Effect probably benign
Transcript: ENSMUST00000028678
AA Change: H146Q

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000028678
Gene: ENSMUSG00000027244
AA Change: H146Q

DomainStartEndE-ValueType
Pfam:ATG13 77 195 1.5e-10 PFAM
low complexity region 252 269 N/A INTRINSIC
low complexity region 423 442 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000076803
AA Change: H146Q

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000076081
Gene: ENSMUSG00000027244
AA Change: H146Q

DomainStartEndE-ValueType
Pfam:ATG13 17 195 1.1e-35 PFAM
low complexity region 386 405 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an autophagy factor and a target of the TOR kinase signaling pathway. The encoded protein is essential for autophagosome formation and mitophagy. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik C A 12: 18,514,802 T22K possibly damaging Het
9530053A07Rik A G 7: 28,140,045 K428E probably benign Het
Abca7 G T 10: 80,000,822 M344I probably benign Het
Alg14 T C 3: 121,361,685 S185P probably damaging Het
Atmin T G 8: 116,957,922 F774V possibly damaging Het
Ccdc150 A G 1: 54,356,704 D782G probably damaging Het
Ccdc86 A G 19: 10,948,999 S79P unknown Het
Cd180 A T 13: 102,705,943 E499V probably damaging Het
Cd24a C T 10: 43,582,751 H73Y unknown Het
Cdh17 C T 4: 11,814,698 P751L probably damaging Het
Chil3 A G 3: 106,148,806 L344S possibly damaging Het
Cspp1 A G 1: 10,135,937 D1129G probably benign Het
Cyth1 C A 11: 118,177,288 V288L probably benign Het
Dpysl4 T A 7: 139,099,773 Y520N possibly damaging Het
Eif4b T A 15: 102,088,694 M249K unknown Het
Enam G A 5: 88,503,025 D798N probably benign Het
Gldc A G 19: 30,118,667 V648A probably damaging Het
Gm7995 A G 14: 42,311,351 I62V possibly damaging Het
Ice1 A G 13: 70,589,797 V2177A possibly damaging Het
Kdm5a T A 6: 120,427,786 S1330T probably benign Het
Mon2 G T 10: 123,006,026 P1553Q probably benign Het
Mylk G C 16: 34,879,524 S419T probably benign Het
Nsd1 A G 13: 55,299,835 T1924A probably damaging Het
Obscn T A 11: 58,997,287 probably null Het
Olfr323 A T 11: 58,625,203 V281D probably damaging Het
Olfr651 T C 7: 104,553,686 F256L probably benign Het
Olfr782 T C 10: 129,351,457 V298A probably benign Het
Olfr806 A T 10: 129,738,201 C239S probably damaging Het
Pcsk1 A G 13: 75,132,210 D718G possibly damaging Het
Pitrm1 A T 13: 6,555,408 N158I probably damaging Het
Pkd1l1 C T 11: 8,947,296 V538M Het
Prkdc G T 16: 15,737,943 G2194C probably damaging Het
Psmc5 T C 11: 106,261,607 M150T possibly damaging Het
Rint1 T C 5: 23,800,802 Y161H probably damaging Het
Sdk2 T C 11: 113,793,737 K1966R probably damaging Het
Slc4a7 G A 14: 14,773,348 E773K probably benign Het
Sp100 A G 1: 85,692,043 K353E possibly damaging Het
Ssh1 T C 5: 113,942,958 T804A probably benign Het
Vipr1 T C 9: 121,653,839 L40P possibly damaging Het
Vmn1r7 A G 6: 57,025,270 S2P probably benign Het
Vwa8 T C 14: 78,935,229 S304P probably damaging Het
Zbed4 T C 15: 88,781,721 M664T probably damaging Het
Other mutations in Atg13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00550:Atg13 APN 2 91692459 missense probably damaging 0.99
IGL00688:Atg13 APN 2 91686497 splice site probably benign
IGL01106:Atg13 APN 2 91695952 missense probably damaging 1.00
IGL01309:Atg13 APN 2 91678831 missense possibly damaging 0.80
IGL03213:Atg13 APN 2 91685167 missense probably damaging 0.96
neodwarf UTSW 2 91684765 splice site probably null
R0201:Atg13 UTSW 2 91684762 splice site probably null
R0571:Atg13 UTSW 2 91678718 splice site probably benign
R0606:Atg13 UTSW 2 91682073 missense probably benign
R1445:Atg13 UTSW 2 91679990 missense probably damaging 0.99
R2281:Atg13 UTSW 2 91679425 missense probably benign 0.17
R4739:Atg13 UTSW 2 91684695 missense probably damaging 1.00
R5356:Atg13 UTSW 2 91692466 nonsense probably null
R5434:Atg13 UTSW 2 91684765 splice site probably null
R6166:Atg13 UTSW 2 91676391 missense probably damaging 0.99
R6891:Atg13 UTSW 2 91685791 missense probably benign 0.42
R7126:Atg13 UTSW 2 91680420 missense probably damaging 0.99
R7571:Atg13 UTSW 2 91680342 critical splice donor site probably null
R7767:Atg13 UTSW 2 91679366 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGCAGTTGGTCTAGTGAC -3'
(R):5'- GCTTACTTCAGCAATGTGTTGGTAG -3'

Sequencing Primer
(F):5'- CTAGTGACTCTGAAAAGCTGAGGTTC -3'
(R):5'- CAATGTGTTGGTAGAGCTCTAAGTAC -3'
Posted On2019-10-24