Incidental Mutation 'R7647:Cdh17'
ID590582
Institutional Source Beutler Lab
Gene Symbol Cdh17
Ensembl Gene ENSMUSG00000028217
Gene Namecadherin 17
SynonymsBILL-cadherin, LI-cadherin, HPT-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R7647 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location11758147-11817895 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 11814698 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 751 (P751L)
Ref Sequence ENSEMBL: ENSMUSP00000029871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029871] [ENSMUST00000108303]
Predicted Effect probably damaging
Transcript: ENSMUST00000029871
AA Change: P751L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029871
Gene: ENSMUSG00000028217
AA Change: P751L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CA 44 123 5.27e-10 SMART
CA 147 241 6.9e-14 SMART
CA 258 337 3.05e-15 SMART
CA 361 446 3.29e-11 SMART
CA 471 564 5.27e-10 SMART
CA 587 664 5.59e-23 SMART
Blast:CA 687 771 5e-39 BLAST
transmembrane domain 784 806 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108303
SMART Domains Protein: ENSMUSP00000103938
Gene: ENSMUSG00000028217

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CA 44 123 5.27e-10 SMART
CA 147 241 6.9e-14 SMART
CA 258 337 3.05e-15 SMART
CA 361 446 3.29e-11 SMART
CA 471 564 5.27e-10 SMART
CA 587 664 5.59e-23 SMART
Meta Mutation Damage Score 0.4799 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily, genes encoding calcium-dependent, membrane-associated glycoproteins. The encoded protein is cadherin-like, consisting of an extracellular region, containing 7 cadherin domains, and a transmembrane region but lacking the conserved cytoplasmic domain. The protein is a component of the gastrointestinal tract and pancreatic ducts, acting as an intestinal proton-dependent peptide transporter in the first step in oral absorption of many medically important peptide-based drugs. The protein may also play a role in the morphological organization of liver and intestine. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygous mutant mice exhibit impaired B lymphocyte development and impaired IgG1 and IgG3 antibody response to T-independent antigen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik C A 12: 18,514,802 T22K possibly damaging Het
9530053A07Rik A G 7: 28,140,045 K428E probably benign Het
Abca7 G T 10: 80,000,822 M344I probably benign Het
Alg14 T C 3: 121,361,685 S185P probably damaging Het
Atg13 A T 2: 91,688,661 H146Q possibly damaging Het
Atmin T G 8: 116,957,922 F774V possibly damaging Het
Ccdc150 A G 1: 54,356,704 D782G probably damaging Het
Ccdc86 A G 19: 10,948,999 S79P unknown Het
Cd180 A T 13: 102,705,943 E499V probably damaging Het
Cd24a C T 10: 43,582,751 H73Y unknown Het
Chil3 A G 3: 106,148,806 L344S possibly damaging Het
Cspp1 A G 1: 10,135,937 D1129G probably benign Het
Cyth1 C A 11: 118,177,288 V288L probably benign Het
Dpysl4 T A 7: 139,099,773 Y520N possibly damaging Het
Eif4b T A 15: 102,088,694 M249K unknown Het
Enam G A 5: 88,503,025 D798N probably benign Het
Gldc A G 19: 30,118,667 V648A probably damaging Het
Gm7995 A G 14: 42,311,351 I62V possibly damaging Het
Ice1 A G 13: 70,589,797 V2177A possibly damaging Het
Kdm5a T A 6: 120,427,786 S1330T probably benign Het
Mon2 G T 10: 123,006,026 P1553Q probably benign Het
Mylk G C 16: 34,879,524 S419T probably benign Het
Nsd1 A G 13: 55,299,835 T1924A probably damaging Het
Obscn T A 11: 58,997,287 probably null Het
Olfr323 A T 11: 58,625,203 V281D probably damaging Het
Olfr651 T C 7: 104,553,686 F256L probably benign Het
Olfr782 T C 10: 129,351,457 V298A probably benign Het
Olfr806 A T 10: 129,738,201 C239S probably damaging Het
Pcsk1 A G 13: 75,132,210 D718G possibly damaging Het
Pitrm1 A T 13: 6,555,408 N158I probably damaging Het
Pkd1l1 C T 11: 8,947,296 V538M Het
Prkdc G T 16: 15,737,943 G2194C probably damaging Het
Psmc5 T C 11: 106,261,607 M150T possibly damaging Het
Rint1 T C 5: 23,800,802 Y161H probably damaging Het
Sdk2 T C 11: 113,793,737 K1966R probably damaging Het
Slc4a7 G A 14: 14,773,348 E773K probably benign Het
Sp100 A G 1: 85,692,043 K353E possibly damaging Het
Ssh1 T C 5: 113,942,958 T804A probably benign Het
Vipr1 T C 9: 121,653,839 L40P possibly damaging Het
Vmn1r7 A G 6: 57,025,270 S2P probably benign Het
Vwa8 T C 14: 78,935,229 S304P probably damaging Het
Zbed4 T C 15: 88,781,721 M664T probably damaging Het
Other mutations in Cdh17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Cdh17 APN 4 11797780 splice site probably benign
IGL00823:Cdh17 APN 4 11783412 missense possibly damaging 0.78
IGL00824:Cdh17 APN 4 11784675 missense probably benign 0.00
IGL01572:Cdh17 APN 4 11784621 splice site probably benign
IGL01602:Cdh17 APN 4 11795670 missense probably damaging 1.00
IGL01605:Cdh17 APN 4 11795670 missense probably damaging 1.00
IGL01759:Cdh17 APN 4 11771262 splice site probably benign
IGL02065:Cdh17 APN 4 11771373 splice site probably benign
IGL02448:Cdh17 APN 4 11784680 missense probably benign
IGL02869:Cdh17 APN 4 11814908 missense probably benign 0.00
IGL03088:Cdh17 APN 4 11810473 missense probably damaging 1.00
Disruptive UTSW 4 11784654 missense probably damaging 1.00
R0054:Cdh17 UTSW 4 11785186 missense possibly damaging 0.59
R0081:Cdh17 UTSW 4 11785280 splice site probably benign
R0101:Cdh17 UTSW 4 11771341 missense probably benign 0.00
R0432:Cdh17 UTSW 4 11771273 nonsense probably null
R0718:Cdh17 UTSW 4 11810451 missense possibly damaging 0.68
R0946:Cdh17 UTSW 4 11795581 missense probably benign 0.01
R1076:Cdh17 UTSW 4 11795581 missense probably benign 0.01
R1217:Cdh17 UTSW 4 11799676 missense probably benign 0.04
R2060:Cdh17 UTSW 4 11803982 missense probably benign 0.03
R3808:Cdh17 UTSW 4 11795671 missense probably damaging 0.99
R3850:Cdh17 UTSW 4 11785201 missense probably damaging 1.00
R4111:Cdh17 UTSW 4 11814628 missense probably damaging 0.99
R4112:Cdh17 UTSW 4 11814628 missense probably damaging 0.99
R4583:Cdh17 UTSW 4 11810466 missense probably benign 0.00
R4683:Cdh17 UTSW 4 11817036 missense possibly damaging 0.78
R4797:Cdh17 UTSW 4 11810390 missense probably benign 0.00
R5050:Cdh17 UTSW 4 11784654 missense probably damaging 1.00
R5071:Cdh17 UTSW 4 11810325 missense probably damaging 0.98
R5569:Cdh17 UTSW 4 11816990 missense probably damaging 0.96
R5790:Cdh17 UTSW 4 11814945 unclassified probably null
R6077:Cdh17 UTSW 4 11803969 missense probably benign 0.22
R6581:Cdh17 UTSW 4 11799615 missense probably damaging 1.00
R7274:Cdh17 UTSW 4 11783174 nonsense probably null
R7649:Cdh17 UTSW 4 11814698 missense probably damaging 1.00
X0067:Cdh17 UTSW 4 11785224 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAAGTTAAAAGGATGTGTTAGCCC -3'
(R):5'- AGAAGTATACCAACTGCCATGC -3'

Sequencing Primer
(F):5'- CTGCTGAGTGAAGGTTCT -3'
(R):5'- TGGCCGGAAACAGCTTC -3'
Posted On2019-10-24