Incidental Mutation 'R7647:Rint1'
ID590583
Institutional Source Beutler Lab
Gene Symbol Rint1
Ensembl Gene ENSMUSG00000028999
Gene NameRAD50 interactor 1
Synonyms2810450M21Rik, 1500019C06Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7647 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location23787711-23820369 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23800802 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 161 (Y161H)
Ref Sequence ENSEMBL: ENSMUSP00000030852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030852] [ENSMUST00000115113]
Predicted Effect probably damaging
Transcript: ENSMUST00000030852
AA Change: Y161H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030852
Gene: ENSMUSG00000028999
AA Change: Y161H

DomainStartEndE-ValueType
Pfam:RINT1_TIP1 304 784 2.3e-135 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115113
AA Change: Y161H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110766
Gene: ENSMUSG00000028999
AA Change: Y161H

DomainStartEndE-ValueType
Pfam:RINT1_TIP1 246 727 1.2e-161 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein first identified for its ability to interact with the RAD50 double strand break repair protein, with the resulting interaction implicated in the regulation of cell cycle progression and telomere length. The encoded protein may also play a role in trafficking of cellular cargo from the endosome to the trans-Golgi network. Mutations in this gene may be associated with breast cancer in human patients. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a mutant allele exhibit early embryonic lethality. Mice heterozygous for a mutant allele exhibit premature death with a life span of 24 months and increased multiple tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik C A 12: 18,514,802 T22K possibly damaging Het
9530053A07Rik A G 7: 28,140,045 K428E probably benign Het
Abca7 G T 10: 80,000,822 M344I probably benign Het
Alg14 T C 3: 121,361,685 S185P probably damaging Het
Atg13 A T 2: 91,688,661 H146Q possibly damaging Het
Atmin T G 8: 116,957,922 F774V possibly damaging Het
Ccdc150 A G 1: 54,356,704 D782G probably damaging Het
Ccdc86 A G 19: 10,948,999 S79P unknown Het
Cd180 A T 13: 102,705,943 E499V probably damaging Het
Cd24a C T 10: 43,582,751 H73Y unknown Het
Cdh17 C T 4: 11,814,698 P751L probably damaging Het
Chil3 A G 3: 106,148,806 L344S possibly damaging Het
Cspp1 A G 1: 10,135,937 D1129G probably benign Het
Cyth1 C A 11: 118,177,288 V288L probably benign Het
Dpysl4 T A 7: 139,099,773 Y520N possibly damaging Het
Eif4b T A 15: 102,088,694 M249K unknown Het
Enam G A 5: 88,503,025 D798N probably benign Het
Gldc A G 19: 30,118,667 V648A probably damaging Het
Gm7995 A G 14: 42,311,351 I62V possibly damaging Het
Ice1 A G 13: 70,589,797 V2177A possibly damaging Het
Kdm5a T A 6: 120,427,786 S1330T probably benign Het
Mon2 G T 10: 123,006,026 P1553Q probably benign Het
Mylk G C 16: 34,879,524 S419T probably benign Het
Nsd1 A G 13: 55,299,835 T1924A probably damaging Het
Obscn T A 11: 58,997,287 probably null Het
Olfr323 A T 11: 58,625,203 V281D probably damaging Het
Olfr651 T C 7: 104,553,686 F256L probably benign Het
Olfr782 T C 10: 129,351,457 V298A probably benign Het
Olfr806 A T 10: 129,738,201 C239S probably damaging Het
Pcsk1 A G 13: 75,132,210 D718G possibly damaging Het
Pitrm1 A T 13: 6,555,408 N158I probably damaging Het
Pkd1l1 C T 11: 8,947,296 V538M Het
Prkdc G T 16: 15,737,943 G2194C probably damaging Het
Psmc5 T C 11: 106,261,607 M150T possibly damaging Het
Sdk2 T C 11: 113,793,737 K1966R probably damaging Het
Slc4a7 G A 14: 14,773,348 E773K probably benign Het
Sp100 A G 1: 85,692,043 K353E possibly damaging Het
Ssh1 T C 5: 113,942,958 T804A probably benign Het
Vipr1 T C 9: 121,653,839 L40P possibly damaging Het
Vmn1r7 A G 6: 57,025,270 S2P probably benign Het
Vwa8 T C 14: 78,935,229 S304P probably damaging Het
Zbed4 T C 15: 88,781,721 M664T probably damaging Het
Other mutations in Rint1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Rint1 APN 5 23794431 missense probably benign 0.00
IGL00596:Rint1 APN 5 23811865 missense probably damaging 0.99
IGL01685:Rint1 APN 5 23787834 unclassified probably benign
IGL02428:Rint1 APN 5 23794452 nonsense probably null
IGL03007:Rint1 APN 5 23815701 missense probably benign 0.00
IGL03280:Rint1 APN 5 23817078 missense probably damaging 1.00
IGL02799:Rint1 UTSW 5 23819480 missense possibly damaging 0.93
R0062:Rint1 UTSW 5 23787828 unclassified probably benign
R0243:Rint1 UTSW 5 23816932 splice site probably benign
R1102:Rint1 UTSW 5 23805567 splice site probably benign
R1552:Rint1 UTSW 5 23800658 missense probably benign 0.00
R1729:Rint1 UTSW 5 23809843 missense probably benign 0.00
R1784:Rint1 UTSW 5 23809843 missense probably benign 0.00
R2070:Rint1 UTSW 5 23810929 missense possibly damaging 0.94
R2920:Rint1 UTSW 5 23805402 missense probably benign 0.00
R3114:Rint1 UTSW 5 23819420 missense probably benign 0.27
R4398:Rint1 UTSW 5 23794447 missense possibly damaging 0.55
R4756:Rint1 UTSW 5 23809793 missense probably damaging 1.00
R5246:Rint1 UTSW 5 23800811 missense probably damaging 0.99
R5452:Rint1 UTSW 5 23794365 missense probably benign 0.01
R5566:Rint1 UTSW 5 23810953 missense probably damaging 1.00
R5709:Rint1 UTSW 5 23815833 missense probably damaging 0.98
R6524:Rint1 UTSW 5 23815739 missense probably benign 0.00
R7346:Rint1 UTSW 5 23815653 missense possibly damaging 0.82
R7549:Rint1 UTSW 5 23815704 missense probably benign
R7634:Rint1 UTSW 5 23805479 missense probably benign 0.00
R7885:Rint1 UTSW 5 23805644 missense probably benign
R7895:Rint1 UTSW 5 23800722 missense probably damaging 0.99
R7968:Rint1 UTSW 5 23805644 missense probably benign
R7978:Rint1 UTSW 5 23800722 missense probably damaging 0.99
Z1088:Rint1 UTSW 5 23805314 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAAAGTGCTTTAAAAGATGCAGAG -3'
(R):5'- TTCTTTCAAGTACAAATTAGGCTCC -3'

Sequencing Primer
(F):5'- TGCAGAGGAATCCAAACAACTTCTTG -3'
(R):5'- AGGCTCCATGAAAAGTTTATGTTC -3'
Posted On2019-10-24