Incidental Mutation 'R7647:Ssh1'
ID590585
Institutional Source Beutler Lab
Gene Symbol Ssh1
Ensembl Gene ENSMUSG00000042121
Gene Nameslingshot protein phosphatase 1
SynonymsmSSH-1L, LOC384311
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7647 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location113937094-113993894 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 113942958 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 804 (T804A)
Ref Sequence ENSEMBL: ENSMUSP00000124312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077689] [ENSMUST00000112298] [ENSMUST00000159592]
Predicted Effect probably benign
Transcript: ENSMUST00000077689
AA Change: T761A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000076873
Gene: ENSMUSG00000042121
AA Change: T761A

DomainStartEndE-ValueType
Pfam:DEK_C 208 261 1.1e-19 PFAM
DSPc 265 403 7.82e-47 SMART
low complexity region 490 503 N/A INTRINSIC
low complexity region 654 669 N/A INTRINSIC
low complexity region 686 704 N/A INTRINSIC
low complexity region 732 748 N/A INTRINSIC
low complexity region 874 892 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112298
AA Change: T782A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000107917
Gene: ENSMUSG00000042121
AA Change: T782A

DomainStartEndE-ValueType
low complexity region 13 22 N/A INTRINSIC
Pfam:DEK_C 229 282 9.5e-20 PFAM
DSPc 286 424 7.82e-47 SMART
low complexity region 511 524 N/A INTRINSIC
low complexity region 675 690 N/A INTRINSIC
low complexity region 707 725 N/A INTRINSIC
low complexity region 753 769 N/A INTRINSIC
low complexity region 895 913 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159592
AA Change: T804A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000124312
Gene: ENSMUSG00000042121
AA Change: T804A

DomainStartEndE-ValueType
low complexity region 13 22 N/A INTRINSIC
Pfam:DEK_C 252 303 2.3e-17 PFAM
DSPc 308 446 7.82e-47 SMART
low complexity region 533 546 N/A INTRINSIC
low complexity region 697 712 N/A INTRINSIC
low complexity region 729 747 N/A INTRINSIC
low complexity region 775 791 N/A INTRINSIC
low complexity region 917 935 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the slingshot homolog (SSH) family of phosphatases, which regulate actin filament dynamics. The SSH proteins dephosphorylate and activate the actin binding/depolymerizing factor cofilin, which subsequently binds to actin filaments and stimulates their disassembly. Cofilin is inactivated by kinases such as LIM domain kinase-1 (LIMK1), which may also be dephosphorylated and inactivated by SSH proteins. The SSH family thus appears to play a role in actin dynamics by reactivating cofilin proteins. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik C A 12: 18,514,802 T22K possibly damaging Het
9530053A07Rik A G 7: 28,140,045 K428E probably benign Het
Abca7 G T 10: 80,000,822 M344I probably benign Het
Alg14 T C 3: 121,361,685 S185P probably damaging Het
Atg13 A T 2: 91,688,661 H146Q possibly damaging Het
Atmin T G 8: 116,957,922 F774V possibly damaging Het
Ccdc150 A G 1: 54,356,704 D782G probably damaging Het
Ccdc86 A G 19: 10,948,999 S79P unknown Het
Cd180 A T 13: 102,705,943 E499V probably damaging Het
Cd24a C T 10: 43,582,751 H73Y unknown Het
Cdh17 C T 4: 11,814,698 P751L probably damaging Het
Chil3 A G 3: 106,148,806 L344S possibly damaging Het
Cspp1 A G 1: 10,135,937 D1129G probably benign Het
Cyth1 C A 11: 118,177,288 V288L probably benign Het
Ddx19a A T 8: 110,976,627 probably null Het
Dpysl4 T A 7: 139,099,773 Y520N possibly damaging Het
Eif4b T A 15: 102,088,694 M249K unknown Het
Enam G A 5: 88,503,025 D798N probably benign Het
Gldc A G 19: 30,118,667 V648A probably damaging Het
Gm7995 A G 14: 42,311,351 I62V possibly damaging Het
Ice1 A G 13: 70,589,797 V2177A possibly damaging Het
Kdm5a T A 6: 120,427,786 S1330T probably benign Het
Mon2 G T 10: 123,006,026 P1553Q probably benign Het
Mylk G C 16: 34,879,524 S419T probably benign Het
Nphs1 T A 7: 30,481,965 probably null Het
Nsd1 A G 13: 55,299,835 T1924A probably damaging Het
Obscn T A 11: 58,997,287 probably null Het
Olfr323 A T 11: 58,625,203 V281D probably damaging Het
Olfr651 T C 7: 104,553,686 F256L probably benign Het
Olfr782 T C 10: 129,351,457 V298A probably benign Het
Olfr806 A T 10: 129,738,201 C239S probably damaging Het
Pcsk1 A G 13: 75,132,210 D718G possibly damaging Het
Pitrm1 A T 13: 6,555,408 N158I probably damaging Het
Pkd1l1 C T 11: 8,947,296 V538M Het
Prkdc G T 16: 15,737,943 G2194C probably damaging Het
Psmc5 T C 11: 106,261,607 M150T possibly damaging Het
Rint1 T C 5: 23,800,802 Y161H probably damaging Het
Sdk2 T C 11: 113,793,737 K1966R probably damaging Het
Sgcb A T 5: 73,639,377 probably null Het
Slc4a7 G A 14: 14,773,348 E773K probably benign Het
Sp100 A G 1: 85,692,043 K353E possibly damaging Het
Vipr1 T C 9: 121,653,839 L40P possibly damaging Het
Vmn1r7 A G 6: 57,025,270 S2P probably benign Het
Vwa8 T C 14: 78,935,229 S304P probably damaging Het
Zbed4 T C 15: 88,781,721 M664T probably damaging Het
Other mutations in Ssh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Ssh1 APN 5 113942576 missense probably damaging 1.00
IGL01432:Ssh1 APN 5 113958822 missense probably benign 0.31
IGL01933:Ssh1 APN 5 113950380 splice site probably benign
IGL01951:Ssh1 APN 5 113966247 missense possibly damaging 0.64
IGL02117:Ssh1 APN 5 113946480 nonsense probably null
IGL02391:Ssh1 APN 5 113942517 missense probably damaging 1.00
R0110:Ssh1 UTSW 5 113946705 missense probably benign 0.00
R0469:Ssh1 UTSW 5 113946705 missense probably benign 0.00
R0510:Ssh1 UTSW 5 113946705 missense probably benign 0.00
R0682:Ssh1 UTSW 5 113960657 missense probably damaging 1.00
R0863:Ssh1 UTSW 5 113966731 missense probably damaging 1.00
R0939:Ssh1 UTSW 5 113970436 missense probably damaging 1.00
R1539:Ssh1 UTSW 5 113952003 missense probably damaging 1.00
R1716:Ssh1 UTSW 5 113952020 missense possibly damaging 0.80
R1754:Ssh1 UTSW 5 113955845 missense probably damaging 0.99
R1867:Ssh1 UTSW 5 113943451 missense probably damaging 1.00
R2261:Ssh1 UTSW 5 113942703 missense possibly damaging 0.94
R2262:Ssh1 UTSW 5 113942703 missense possibly damaging 0.94
R2497:Ssh1 UTSW 5 113958858 missense probably damaging 1.00
R3774:Ssh1 UTSW 5 113966722 missense probably damaging 1.00
R3922:Ssh1 UTSW 5 113942708 missense possibly damaging 0.52
R5120:Ssh1 UTSW 5 113957398 missense possibly damaging 0.89
R5283:Ssh1 UTSW 5 113950545 missense probably damaging 1.00
R5810:Ssh1 UTSW 5 113946566 missense probably benign 0.05
R5877:Ssh1 UTSW 5 113943120 missense probably benign 0.29
R6140:Ssh1 UTSW 5 113942631 missense probably benign 0.16
R6360:Ssh1 UTSW 5 113961347 splice site probably null
R6612:Ssh1 UTSW 5 113958730 missense probably benign 0.43
R6819:Ssh1 UTSW 5 113946790 missense probably benign
R6855:Ssh1 UTSW 5 113942575 missense probably damaging 1.00
R7389:Ssh1 UTSW 5 113958831 missense probably benign 0.28
R7470:Ssh1 UTSW 5 113942427 missense possibly damaging 0.63
R7568:Ssh1 UTSW 5 113957380 splice site probably null
R7649:Ssh1 UTSW 5 113950551 missense probably benign 0.12
R7754:Ssh1 UTSW 5 113966234 missense probably benign 0.31
R7887:Ssh1 UTSW 5 113961349 critical splice donor site probably null
R7970:Ssh1 UTSW 5 113961349 critical splice donor site probably null
Z1177:Ssh1 UTSW 5 113966294 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CTACAGGCTGTTCTTCCGAC -3'
(R):5'- TAGAGCCTTCCAGAGAGACC -3'

Sequencing Primer
(F):5'- AGCTTGGCTGCACAGGG -3'
(R):5'- GAGCCTTCCAGAGAGACCTCAAAAG -3'
Posted On2019-10-24