Incidental Mutation 'R7647:Olfr651'
ID590589
Institutional Source Beutler Lab
Gene Symbol Olfr651
Ensembl Gene ENSMUSG00000073928
Gene Nameolfactory receptor 651
SynonymsGA_x6K02T2PBJ9-7179540-7180481, MOR31-11
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R7647 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location104550133-104554422 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104553686 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 256 (F256L)
Ref Sequence ENSEMBL: ENSMUSP00000150776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098176] [ENSMUST00000216904]
Predicted Effect probably benign
Transcript: ENSMUST00000098176
AA Change: F256L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000095778
Gene: ENSMUSG00000073928
AA Change: F256L

DomainStartEndE-ValueType
Pfam:7tm_4 31 310 4.1e-104 PFAM
Pfam:7TM_GPCR_Srsx 35 303 1e-10 PFAM
Pfam:7tm_1 41 292 4.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216904
AA Change: F256L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik C A 12: 18,514,802 T22K possibly damaging Het
9530053A07Rik A G 7: 28,140,045 K428E probably benign Het
Abca7 G T 10: 80,000,822 M344I probably benign Het
Alg14 T C 3: 121,361,685 S185P probably damaging Het
Atg13 A T 2: 91,688,661 H146Q possibly damaging Het
Atmin T G 8: 116,957,922 F774V possibly damaging Het
Ccdc150 A G 1: 54,356,704 D782G probably damaging Het
Ccdc86 A G 19: 10,948,999 S79P unknown Het
Cd180 A T 13: 102,705,943 E499V probably damaging Het
Cd24a C T 10: 43,582,751 H73Y unknown Het
Cdh17 C T 4: 11,814,698 P751L probably damaging Het
Chil3 A G 3: 106,148,806 L344S possibly damaging Het
Cspp1 A G 1: 10,135,937 D1129G probably benign Het
Cyth1 C A 11: 118,177,288 V288L probably benign Het
Dpysl4 T A 7: 139,099,773 Y520N possibly damaging Het
Eif4b T A 15: 102,088,694 M249K unknown Het
Enam G A 5: 88,503,025 D798N probably benign Het
Gldc A G 19: 30,118,667 V648A probably damaging Het
Gm7995 A G 14: 42,311,351 I62V possibly damaging Het
Ice1 A G 13: 70,589,797 V2177A possibly damaging Het
Kdm5a T A 6: 120,427,786 S1330T probably benign Het
Mon2 G T 10: 123,006,026 P1553Q probably benign Het
Mylk G C 16: 34,879,524 S419T probably benign Het
Nsd1 A G 13: 55,299,835 T1924A probably damaging Het
Obscn T A 11: 58,997,287 probably null Het
Olfr323 A T 11: 58,625,203 V281D probably damaging Het
Olfr782 T C 10: 129,351,457 V298A probably benign Het
Olfr806 A T 10: 129,738,201 C239S probably damaging Het
Pcsk1 A G 13: 75,132,210 D718G possibly damaging Het
Pitrm1 A T 13: 6,555,408 N158I probably damaging Het
Pkd1l1 C T 11: 8,947,296 V538M Het
Prkdc G T 16: 15,737,943 G2194C probably damaging Het
Psmc5 T C 11: 106,261,607 M150T possibly damaging Het
Rint1 T C 5: 23,800,802 Y161H probably damaging Het
Sdk2 T C 11: 113,793,737 K1966R probably damaging Het
Slc4a7 G A 14: 14,773,348 E773K probably benign Het
Sp100 A G 1: 85,692,043 K353E possibly damaging Het
Ssh1 T C 5: 113,942,958 T804A probably benign Het
Vipr1 T C 9: 121,653,839 L40P possibly damaging Het
Vmn1r7 A G 6: 57,025,270 S2P probably benign Het
Vwa8 T C 14: 78,935,229 S304P probably damaging Het
Zbed4 T C 15: 88,781,721 M664T probably damaging Het
Other mutations in Olfr651
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Olfr651 APN 7 104553092 missense probably benign 0.18
IGL01120:Olfr651 APN 7 104553345 missense probably benign
IGL01325:Olfr651 APN 7 104553689 missense probably damaging 1.00
IGL01590:Olfr651 APN 7 104553575 missense probably benign 0.00
IGL02625:Olfr651 APN 7 104553573 missense probably damaging 1.00
IGL02685:Olfr651 APN 7 104553150 missense probably benign 0.35
P0157:Olfr651 UTSW 7 104553507 missense probably damaging 1.00
R0087:Olfr651 UTSW 7 104553662 missense possibly damaging 0.73
R0399:Olfr651 UTSW 7 104553369 missense probably benign 0.05
R0547:Olfr651 UTSW 7 104553356 missense probably benign 0.01
R0630:Olfr651 UTSW 7 104553791 missense probably benign 0.27
R1014:Olfr651 UTSW 7 104553176 missense probably damaging 1.00
R1127:Olfr651 UTSW 7 104553086 missense possibly damaging 0.94
R1724:Olfr651 UTSW 7 104553228 missense probably damaging 1.00
R2473:Olfr651 UTSW 7 104552939 missense possibly damaging 0.93
R3115:Olfr651 UTSW 7 104553088 missense probably benign 0.13
R3116:Olfr651 UTSW 7 104553088 missense probably benign 0.13
R3834:Olfr651 UTSW 7 104553345 missense probably benign 0.43
R4027:Olfr651 UTSW 7 104553323 missense possibly damaging 0.90
R4423:Olfr651 UTSW 7 104553345 missense probably benign
R4907:Olfr651 UTSW 7 104553311 missense probably damaging 0.97
R4984:Olfr651 UTSW 7 104553021 missense probably benign 0.38
R5266:Olfr651 UTSW 7 104553819 missense probably benign 0.00
R5592:Olfr651 UTSW 7 104553731 missense probably benign 0.28
R6441:Olfr651 UTSW 7 104553335 nonsense probably null
R7463:Olfr651 UTSW 7 104553482 missense possibly damaging 0.88
X0067:Olfr651 UTSW 7 104553387 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AAGGCTTTCCTCTGCAGAC -3'
(R):5'- GCTTTCAGCACACACTCATTG -3'

Sequencing Primer
(F):5'- TGCAGACATCTCTATCAACATCTGG -3'
(R):5'- CAACTGGATTTAGAGCAGG -3'
Posted On2019-10-24