Incidental Mutation 'R7647:Dpysl4'
ID590590
Institutional Source Beutler Lab
Gene Symbol Dpysl4
Ensembl Gene ENSMUSG00000025478
Gene Namedihydropyrimidinase-like 4
SynonymsDrp-4, Ulip4, Crmp3, CRMP-3, unc-33-like phosphoprotein 4, DPY4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R7647 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location139086001-139102704 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 139099773 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 520 (Y520N)
Ref Sequence ENSEMBL: ENSMUSP00000112896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016125] [ENSMUST00000026551] [ENSMUST00000121184] [ENSMUST00000165870]
Predicted Effect probably benign
Transcript: ENSMUST00000016125
SMART Domains Protein: ENSMUSP00000016125
Gene: ENSMUSG00000015981

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 32 48 N/A INTRINSIC
low complexity region 62 80 N/A INTRINSIC
S_TKc 94 354 9.16e-82 SMART
low complexity region 398 407 N/A INTRINSIC
low complexity region 408 418 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000026551
AA Change: Y499N

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000026551
Gene: ENSMUSG00000025478
AA Change: Y499N

DomainStartEndE-ValueType
Pfam:Amidohydro_1 64 453 4.5e-40 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000121184
AA Change: Y520N

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112896
Gene: ENSMUSG00000025478
AA Change: Y520N

DomainStartEndE-ValueType
Pfam:Amidohydro_1 85 474 1.1e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165870
SMART Domains Protein: ENSMUSP00000126638
Gene: ENSMUSG00000015981

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 232 1.2e-30 PFAM
Pfam:Pkinase 1 235 1.5e-51 PFAM
Pfam:Kinase-like 12 223 6.2e-13 PFAM
low complexity region 280 289 N/A INTRINSIC
low complexity region 290 300 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice exhibit abnormal neurite outgrowth and lamination in the hippocampus, altered dendrite arborization and spine morphology in hippocampal pyramidal cells, and impaired LTP induction in the CA1 region. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik C A 12: 18,514,802 T22K possibly damaging Het
9530053A07Rik A G 7: 28,140,045 K428E probably benign Het
Abca7 G T 10: 80,000,822 M344I probably benign Het
Alg14 T C 3: 121,361,685 S185P probably damaging Het
Atg13 A T 2: 91,688,661 H146Q possibly damaging Het
Atmin T G 8: 116,957,922 F774V possibly damaging Het
Ccdc150 A G 1: 54,356,704 D782G probably damaging Het
Ccdc86 A G 19: 10,948,999 S79P unknown Het
Cd180 A T 13: 102,705,943 E499V probably damaging Het
Cd24a C T 10: 43,582,751 H73Y unknown Het
Cdh17 C T 4: 11,814,698 P751L probably damaging Het
Chil3 A G 3: 106,148,806 L344S possibly damaging Het
Cspp1 A G 1: 10,135,937 D1129G probably benign Het
Cyth1 C A 11: 118,177,288 V288L probably benign Het
Eif4b T A 15: 102,088,694 M249K unknown Het
Enam G A 5: 88,503,025 D798N probably benign Het
Gldc A G 19: 30,118,667 V648A probably damaging Het
Gm7995 A G 14: 42,311,351 I62V possibly damaging Het
Ice1 A G 13: 70,589,797 V2177A possibly damaging Het
Kdm5a T A 6: 120,427,786 S1330T probably benign Het
Mon2 G T 10: 123,006,026 P1553Q probably benign Het
Mylk G C 16: 34,879,524 S419T probably benign Het
Nsd1 A G 13: 55,299,835 T1924A probably damaging Het
Obscn T A 11: 58,997,287 probably null Het
Olfr323 A T 11: 58,625,203 V281D probably damaging Het
Olfr651 T C 7: 104,553,686 F256L probably benign Het
Olfr782 T C 10: 129,351,457 V298A probably benign Het
Olfr806 A T 10: 129,738,201 C239S probably damaging Het
Pcsk1 A G 13: 75,132,210 D718G possibly damaging Het
Pitrm1 A T 13: 6,555,408 N158I probably damaging Het
Pkd1l1 C T 11: 8,947,296 V538M Het
Prkdc G T 16: 15,737,943 G2194C probably damaging Het
Psmc5 T C 11: 106,261,607 M150T possibly damaging Het
Rint1 T C 5: 23,800,802 Y161H probably damaging Het
Sdk2 T C 11: 113,793,737 K1966R probably damaging Het
Slc4a7 G A 14: 14,773,348 E773K probably benign Het
Sp100 A G 1: 85,692,043 K353E possibly damaging Het
Ssh1 T C 5: 113,942,958 T804A probably benign Het
Vipr1 T C 9: 121,653,839 L40P possibly damaging Het
Vmn1r7 A G 6: 57,025,270 S2P probably benign Het
Vwa8 T C 14: 78,935,229 S304P probably damaging Het
Zbed4 T C 15: 88,781,721 M664T probably damaging Het
Other mutations in Dpysl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Dpysl4 APN 7 139096176 missense probably damaging 1.00
IGL01836:Dpysl4 APN 7 139096173 missense possibly damaging 0.96
IGL02447:Dpysl4 APN 7 139098600 missense probably damaging 1.00
IGL02515:Dpysl4 APN 7 139096735 missense probably damaging 1.00
IGL03169:Dpysl4 APN 7 139099910 splice site probably null
PIT4382001:Dpysl4 UTSW 7 139089578 nonsense probably null
R0012:Dpysl4 UTSW 7 139097883 missense probably benign 0.32
R0012:Dpysl4 UTSW 7 139097883 missense probably benign 0.32
R1624:Dpysl4 UTSW 7 139089553 missense probably damaging 1.00
R1642:Dpysl4 UTSW 7 139090338 missense probably damaging 1.00
R1860:Dpysl4 UTSW 7 139090299 missense probably benign
R1885:Dpysl4 UTSW 7 139096807 missense probably damaging 1.00
R1995:Dpysl4 UTSW 7 139096770 missense probably benign
R2698:Dpysl4 UTSW 7 139096765 missense probably damaging 1.00
R3032:Dpysl4 UTSW 7 139096236 missense probably benign 0.01
R3762:Dpysl4 UTSW 7 139096756 missense probably damaging 1.00
R3851:Dpysl4 UTSW 7 139100935 missense probably damaging 1.00
R3852:Dpysl4 UTSW 7 139100935 missense probably damaging 1.00
R4609:Dpysl4 UTSW 7 139098621 missense probably damaging 0.99
R4972:Dpysl4 UTSW 7 139090290 missense probably damaging 1.00
R5538:Dpysl4 UTSW 7 139091990 missense probably benign
R5608:Dpysl4 UTSW 7 139098543 missense probably damaging 0.97
R5762:Dpysl4 UTSW 7 139091937 missense probably benign
R5887:Dpysl4 UTSW 7 139096276 missense possibly damaging 0.72
R6022:Dpysl4 UTSW 7 139086084 unclassified probably benign
R6060:Dpysl4 UTSW 7 139089408 start codon destroyed probably null
R6180:Dpysl4 UTSW 7 139090334 missense probably damaging 1.00
R6328:Dpysl4 UTSW 7 139099818 missense probably benign
R6809:Dpysl4 UTSW 7 139093660 missense probably benign 0.19
R6949:Dpysl4 UTSW 7 139091999 missense probably damaging 1.00
R7695:Dpysl4 UTSW 7 139086123 start codon destroyed probably null 0.00
R7751:Dpysl4 UTSW 7 139089540 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTGAGGGAGTTGTATATGAAGCTG -3'
(R):5'- GTCTTCAGCTGAGCATAGGG -3'

Sequencing Primer
(F):5'- ATATGAAGCTGTGTGTGATCCTTTC -3'
(R):5'- CTGTTTTACCTGGCAGAAGAGC -3'
Posted On2019-10-24