Incidental Mutation 'R7647:Atmin'
ID590591
Institutional Source Beutler Lab
Gene Symbol Atmin
Ensembl Gene ENSMUSG00000047388
Gene NameATM interactor
Synonymsgpg6, Asciz
Accession Numbers

Ncbi RefSeq: NM_177700.4; MGI:2682328

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7647 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location116943393-116960445 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 116957922 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 774 (F774V)
Ref Sequence ENSEMBL: ENSMUSP00000104727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109099]
Predicted Effect possibly damaging
Transcript: ENSMUST00000109099
AA Change: F774V

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104727
Gene: ENSMUSG00000047388
AA Change: F774V

DomainStartEndE-ValueType
low complexity region 2 34 N/A INTRINSIC
low complexity region 46 62 N/A INTRINSIC
ZnF_C2H2 80 105 2.49e-1 SMART
ZnF_C2H2 127 156 7.11e0 SMART
ZnF_C2H2 161 181 4.5e1 SMART
ZnF_C2H2 187 210 1.06e2 SMART
low complexity region 289 304 N/A INTRINSIC
low complexity region 644 657 N/A INTRINSIC
low complexity region 722 738 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype Strain: 4868762; 4881337
Lethality: E16-E19
PHENOTYPE: Mice homozygous for a knock-out allele exhibit fetal lethality, craniofacial defects, midbrain exencephaly, and premature senescence of mouse embryonic fibroblasts. Homozygotes for an ENU-induced mutation exhibit left-right patterning defects. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik C A 12: 18,514,802 T22K possibly damaging Het
9530053A07Rik A G 7: 28,140,045 K428E probably benign Het
Abca7 G T 10: 80,000,822 M344I probably benign Het
Alg14 T C 3: 121,361,685 S185P probably damaging Het
Atg13 A T 2: 91,688,661 H146Q possibly damaging Het
Ccdc150 A G 1: 54,356,704 D782G probably damaging Het
Ccdc86 A G 19: 10,948,999 S79P unknown Het
Cd180 A T 13: 102,705,943 E499V probably damaging Het
Cd24a C T 10: 43,582,751 H73Y unknown Het
Cdh17 C T 4: 11,814,698 P751L probably damaging Het
Chil3 A G 3: 106,148,806 L344S possibly damaging Het
Cspp1 A G 1: 10,135,937 D1129G probably benign Het
Cyth1 C A 11: 118,177,288 V288L probably benign Het
Dpysl4 T A 7: 139,099,773 Y520N possibly damaging Het
Eif4b T A 15: 102,088,694 M249K unknown Het
Enam G A 5: 88,503,025 D798N probably benign Het
Gldc A G 19: 30,118,667 V648A probably damaging Het
Gm7995 A G 14: 42,311,351 I62V possibly damaging Het
Ice1 A G 13: 70,589,797 V2177A possibly damaging Het
Kdm5a T A 6: 120,427,786 S1330T probably benign Het
Mon2 G T 10: 123,006,026 P1553Q probably benign Het
Mylk G C 16: 34,879,524 S419T probably benign Het
Nsd1 A G 13: 55,299,835 T1924A probably damaging Het
Obscn T A 11: 58,997,287 probably null Het
Olfr323 A T 11: 58,625,203 V281D probably damaging Het
Olfr651 T C 7: 104,553,686 F256L probably benign Het
Olfr782 T C 10: 129,351,457 V298A probably benign Het
Olfr806 A T 10: 129,738,201 C239S probably damaging Het
Pcsk1 A G 13: 75,132,210 D718G possibly damaging Het
Pitrm1 A T 13: 6,555,408 N158I probably damaging Het
Pkd1l1 C T 11: 8,947,296 V538M Het
Prkdc G T 16: 15,737,943 G2194C probably damaging Het
Psmc5 T C 11: 106,261,607 M150T possibly damaging Het
Rint1 T C 5: 23,800,802 Y161H probably damaging Het
Sdk2 T C 11: 113,793,737 K1966R probably damaging Het
Slc4a7 G A 14: 14,773,348 E773K probably benign Het
Sp100 A G 1: 85,692,043 K353E possibly damaging Het
Ssh1 T C 5: 113,942,958 T804A probably benign Het
Vipr1 T C 9: 121,653,839 L40P possibly damaging Het
Vmn1r7 A G 6: 57,025,270 S2P probably benign Het
Vwa8 T C 14: 78,935,229 S304P probably damaging Het
Zbed4 T C 15: 88,781,721 M664T probably damaging Het
Other mutations in Atmin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Atmin APN 8 116956657 missense probably damaging 1.00
IGL02680:Atmin APN 8 116957497 missense probably damaging 1.00
IGL03355:Atmin APN 8 116957425 nonsense probably null
K3955:Atmin UTSW 8 116957036 nonsense probably null
P0038:Atmin UTSW 8 116957036 nonsense probably null
R1440:Atmin UTSW 8 116957376 missense probably damaging 0.98
R1498:Atmin UTSW 8 116954801 missense probably benign 0.21
R1515:Atmin UTSW 8 116954840 missense possibly damaging 0.87
R2094:Atmin UTSW 8 116957538 missense probably damaging 1.00
R2306:Atmin UTSW 8 116957650 missense probably benign 0.04
R2363:Atmin UTSW 8 116954914 critical splice donor site probably null
R2866:Atmin UTSW 8 116956373 missense probably benign
R3743:Atmin UTSW 8 116956573 missense probably benign 0.02
R3901:Atmin UTSW 8 116956297 missense probably benign 0.00
R3902:Atmin UTSW 8 116956297 missense probably benign 0.00
R4664:Atmin UTSW 8 116957959 missense probably damaging 1.00
R4665:Atmin UTSW 8 116957959 missense probably damaging 1.00
R4666:Atmin UTSW 8 116957959 missense probably damaging 1.00
R5441:Atmin UTSW 8 116957957 missense probably damaging 0.99
R5496:Atmin UTSW 8 116957172 missense probably benign 0.01
R6914:Atmin UTSW 8 116956713 missense probably benign 0.02
R6942:Atmin UTSW 8 116956713 missense probably benign 0.02
R6965:Atmin UTSW 8 116957038 missense probably damaging 1.00
R7172:Atmin UTSW 8 116956542 missense probably damaging 1.00
R7492:Atmin UTSW 8 116956918 missense probably damaging 1.00
R8068:Atmin UTSW 8 116956650 missense probably benign 0.00
V7732:Atmin UTSW 8 116956479 missense probably damaging 1.00
X0020:Atmin UTSW 8 116952982 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAGCATCCTGAAACACTC -3'
(R):5'- CTGAAGAGAATCTAAACAGCTGCC -3'

Sequencing Primer
(F):5'- TGAAACACTCCAGCTTCTCCATGAG -3'
(R):5'- TGAGCCCATGTTCTAAACGC -3'
Posted On2019-10-24