Incidental Mutation 'R7647:Olfr806'
ID590597
Institutional Source Beutler Lab
Gene Symbol Olfr806
Ensembl Gene ENSMUSG00000071065
Gene Nameolfactory receptor 806
SynonymsMOR110-5, MOR110-12, GA_x6K02T2PULF-11417610-11416669
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R7647 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location129735571-129741921 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 129738201 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 239 (C239S)
Ref Sequence ENSEMBL: ENSMUSP00000150380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095245] [ENSMUST00000213239] [ENSMUST00000215142]
Predicted Effect probably damaging
Transcript: ENSMUST00000095245
AA Change: C239S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000092873
Gene: ENSMUSG00000071065
AA Change: C239S

DomainStartEndE-ValueType
Pfam:7tm_4 28 306 2.6e-52 PFAM
Pfam:7tm_1 39 288 4.5e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213239
AA Change: C239S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000215142
AA Change: C239S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik C A 12: 18,514,802 T22K possibly damaging Het
9530053A07Rik A G 7: 28,140,045 K428E probably benign Het
Abca7 G T 10: 80,000,822 M344I probably benign Het
Alg14 T C 3: 121,361,685 S185P probably damaging Het
Atg13 A T 2: 91,688,661 H146Q possibly damaging Het
Atmin T G 8: 116,957,922 F774V possibly damaging Het
Ccdc150 A G 1: 54,356,704 D782G probably damaging Het
Ccdc86 A G 19: 10,948,999 S79P unknown Het
Cd180 A T 13: 102,705,943 E499V probably damaging Het
Cd24a C T 10: 43,582,751 H73Y unknown Het
Cdh17 C T 4: 11,814,698 P751L probably damaging Het
Chil3 A G 3: 106,148,806 L344S possibly damaging Het
Cspp1 A G 1: 10,135,937 D1129G probably benign Het
Cyth1 C A 11: 118,177,288 V288L probably benign Het
Dpysl4 T A 7: 139,099,773 Y520N possibly damaging Het
Eif4b T A 15: 102,088,694 M249K unknown Het
Enam G A 5: 88,503,025 D798N probably benign Het
Gldc A G 19: 30,118,667 V648A probably damaging Het
Gm7995 A G 14: 42,311,351 I62V possibly damaging Het
Ice1 A G 13: 70,589,797 V2177A possibly damaging Het
Kdm5a T A 6: 120,427,786 S1330T probably benign Het
Mon2 G T 10: 123,006,026 P1553Q probably benign Het
Mylk G C 16: 34,879,524 S419T probably benign Het
Nsd1 A G 13: 55,299,835 T1924A probably damaging Het
Obscn T A 11: 58,997,287 probably null Het
Olfr323 A T 11: 58,625,203 V281D probably damaging Het
Olfr651 T C 7: 104,553,686 F256L probably benign Het
Olfr782 T C 10: 129,351,457 V298A probably benign Het
Pcsk1 A G 13: 75,132,210 D718G possibly damaging Het
Pitrm1 A T 13: 6,555,408 N158I probably damaging Het
Pkd1l1 C T 11: 8,947,296 V538M Het
Prkdc G T 16: 15,737,943 G2194C probably damaging Het
Psmc5 T C 11: 106,261,607 M150T possibly damaging Het
Rint1 T C 5: 23,800,802 Y161H probably damaging Het
Sdk2 T C 11: 113,793,737 K1966R probably damaging Het
Slc4a7 G A 14: 14,773,348 E773K probably benign Het
Sp100 A G 1: 85,692,043 K353E possibly damaging Het
Ssh1 T C 5: 113,942,958 T804A probably benign Het
Vipr1 T C 9: 121,653,839 L40P possibly damaging Het
Vmn1r7 A G 6: 57,025,270 S2P probably benign Het
Vwa8 T C 14: 78,935,229 S304P probably damaging Het
Zbed4 T C 15: 88,781,721 M664T probably damaging Het
Other mutations in Olfr806
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01875:Olfr806 APN 10 129738922 utr 5 prime probably benign
IGL02090:Olfr806 APN 10 129738312 missense probably benign
IGL02328:Olfr806 APN 10 129738026 missense probably benign 0.35
IGL02572:Olfr806 APN 10 129738866 missense possibly damaging 0.81
R1773:Olfr806 UTSW 10 129738443 missense probably damaging 0.97
R1797:Olfr806 UTSW 10 129738709 missense probably benign 0.03
R4430:Olfr806 UTSW 10 129738261 missense probably damaging 1.00
R5704:Olfr806 UTSW 10 129738816 missense probably benign 0.00
R6140:Olfr806 UTSW 10 129738654 missense possibly damaging 0.95
R6655:Olfr806 UTSW 10 129738087 missense possibly damaging 0.96
R6858:Olfr806 UTSW 10 129738464 missense probably damaging 1.00
R7879:Olfr806 UTSW 10 129738690 missense probably benign 0.15
R7962:Olfr806 UTSW 10 129738690 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- TCACCTGCTGGTTCCTTAGG -3'
(R):5'- CTCAAACTGGAATTCTGTGCTTCC -3'

Sequencing Primer
(F):5'- CTGGTTCCTTAGGGTGTAAATGAAAG -3'
(R):5'- CTGTGCTTCCAAAACTGTAGATCAC -3'
Posted On2019-10-24