Incidental Mutation 'R0234:Slc17a3'
ID59061
Institutional Source Beutler Lab
Gene Symbol Slc17a3
Ensembl Gene ENSMUSG00000036083
Gene Namesolute carrier family 17 (sodium phosphate), member 3
SynonymsNpt4
MMRRC Submission 038475-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0234 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location23839434-23860716 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 23855858 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 293 (S293F)
Ref Sequence ENSEMBL: ENSMUSP00000131308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039721] [ENSMUST00000091698] [ENSMUST00000110422] [ENSMUST00000166467]
Predicted Effect probably damaging
Transcript: ENSMUST00000039721
AA Change: S293F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039062
Gene: ENSMUSG00000036083
AA Change: S293F

DomainStartEndE-ValueType
Pfam:MFS_1 45 377 3.3e-46 PFAM
transmembrane domain 393 415 N/A INTRINSIC
transmembrane domain 430 452 N/A INTRINSIC
transmembrane domain 459 481 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000091698
AA Change: S215F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089290
Gene: ENSMUSG00000036083
AA Change: S215F

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
Pfam:MFS_1 95 293 2.8e-25 PFAM
transmembrane domain 310 332 N/A INTRINSIC
transmembrane domain 352 369 N/A INTRINSIC
transmembrane domain 379 398 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110422
AA Change: S257F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106052
Gene: ENSMUSG00000036083
AA Change: S257F

DomainStartEndE-ValueType
Pfam:MFS_1 39 425 6.7e-47 PFAM
transmembrane domain 453 475 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166467
AA Change: S293F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131308
Gene: ENSMUSG00000036083
AA Change: S293F

DomainStartEndE-ValueType
Pfam:MFS_1 9 338 2.3e-46 PFAM
transmembrane domain 357 379 N/A INTRINSIC
transmembrane domain 394 416 N/A INTRINSIC
transmembrane domain 423 445 N/A INTRINSIC
Meta Mutation Damage Score 0.8156 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a voltage-driven transporter that excretes intracellular urate and organic anions from the blood into renal tubule cells. Two transcript variants encoding different isoforms have been found for this gene. The longer isoform is a plasma membrane protein with transporter activity while the shorter isoform localizes to the endoplasmic reticulum. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik T A 7: 131,194,303 probably null Het
A3galt2 A G 4: 128,767,148 R197G possibly damaging Het
Acacb A T 5: 114,209,817 H983L probably damaging Het
Adal T A 2: 121,148,317 D139E probably benign Het
Adam6b G A 12: 113,490,610 R349H probably damaging Het
Agap1 A G 1: 89,671,212 K331E probably damaging Het
Alyref T C 11: 120,598,307 D11G probably damaging Het
B3gat1 A G 9: 26,756,081 E203G probably damaging Het
Bsn T C 9: 108,116,396 E719G possibly damaging Het
Cap2 G C 13: 46,638,022 probably null Het
Ccni A G 5: 93,202,327 V31A probably benign Het
Cfap54 A T 10: 92,899,160 L2343* probably null Het
Clns1a T A 7: 97,714,032 Y204N possibly damaging Het
Cox11 C T 11: 90,644,500 T259I probably damaging Het
D430042O09Rik T C 7: 125,795,385 V211A probably benign Het
Dsp A G 13: 38,187,893 N940S probably benign Het
Erbb2 T C 11: 98,436,439 V1181A probably benign Het
Exoc4 T C 6: 33,862,087 V686A possibly damaging Het
F830045P16Rik A G 2: 129,463,464 V330A possibly damaging Het
Fam71a T C 1: 191,162,908 S513G probably benign Het
Fbf1 A C 11: 116,155,034 F245V probably damaging Het
Fut10 T A 8: 31,236,197 F327I probably damaging Het
Galnt1 C T 18: 24,254,633 P144S probably damaging Het
Ghrhr A T 6: 55,379,186 D88V possibly damaging Het
Greb1l T A 18: 10,560,331 C1864S probably damaging Het
Hist1h1c T C 13: 23,739,123 I92T probably benign Het
Hps1 T C 19: 42,762,553 E336G probably damaging Het
Ibsp GGAAGAAGAAGAAGAAGA GGAAGAAGAAGAAGA 5: 104,310,069 probably benign Het
Irgc1 C A 7: 24,433,328 E21D possibly damaging Het
Itsn1 A T 16: 91,828,280 R590* probably null Het
Lmln T C 16: 33,066,324 V67A probably damaging Het
Lsm14a T C 7: 34,365,617 Q179R probably damaging Het
Ltbr A C 6: 125,312,873 D119E probably benign Het
Mrc1 A G 2: 14,279,894 T565A possibly damaging Het
Muc6 A C 7: 141,649,674 N473K possibly damaging Het
Myocd A T 11: 65,187,240 D448E probably benign Het
Neil2 T A 14: 63,183,526 I239F probably damaging Het
Npnt A G 3: 132,914,414 F123S possibly damaging Het
Olfr1164 T A 2: 88,093,022 R305* probably null Het
Olfr117 T A 17: 37,660,106 I76F probably damaging Het
Olfr1309 T C 2: 111,983,300 Y258C probably damaging Het
Olfr1501 C T 19: 13,838,538 V212M possibly damaging Het
Olfr683 T C 7: 105,144,074 D73G probably damaging Het
Olfr686 C A 7: 105,203,614 C243F probably damaging Het
Olfr933 A C 9: 38,976,251 probably null Het
Pcnx3 T C 19: 5,672,618 T941A probably benign Het
Phldb3 G A 7: 24,612,579 R106Q probably benign Het
Pitrm1 C A 13: 6,575,079 Y864* probably null Het
Plcb4 T C 2: 135,982,075 I844T probably benign Het
Plekhg5 T C 4: 152,112,219 C695R probably damaging Het
Ppp1r3b T A 8: 35,384,501 F165I probably damaging Het
Prr5 T A 15: 84,703,121 F357L probably damaging Het
Rasgrf1 A T 9: 90,009,366 I1046F probably damaging Het
Rbm15b T C 9: 106,885,364 Y535C probably damaging Het
Rbp3 A T 14: 33,955,901 E602V probably damaging Het
Rimklb T C 6: 122,456,333 N343S probably benign Het
Rrp12 A G 19: 41,871,760 L1008P probably damaging Het
Sec63 C T 10: 42,798,798 R226C probably damaging Het
Sirpa T C 2: 129,615,468 V154A probably damaging Het
Slc13a5 C G 11: 72,250,800 V405L probably damaging Het
Slc22a23 G A 13: 34,183,261 T588I probably damaging Het
Slc22a27 C A 19: 7,926,791 probably benign Het
Slc4a4 A C 5: 89,156,336 H502P possibly damaging Het
Slc5a5 A T 8: 70,889,633 M258K probably damaging Het
Spry4 A G 18: 38,590,089 I207T possibly damaging Het
Stk11ip A G 1: 75,529,067 D460G possibly damaging Het
Syn3 T A 10: 86,448,886 I117F possibly damaging Het
Tead4 C T 6: 128,243,402 A224T probably damaging Het
Tmtc3 A T 10: 100,450,322 N546K probably benign Het
Tnn T A 1: 160,088,466 H1227L probably damaging Het
Tor2a G A 2: 32,758,704 G62D probably damaging Het
Trf T C 9: 103,226,879 probably null Het
Ubr5 T C 15: 37,968,493 T2727A probably damaging Het
Vmn2r27 T A 6: 124,231,619 T56S probably benign Het
Wipf3 T G 6: 54,496,501 L458R probably damaging Het
Zfp236 T C 18: 82,629,994 K966R probably damaging Het
Zfp27 T A 7: 29,894,107 H811L possibly damaging Het
Zfp366 A G 13: 99,234,260 H496R probably damaging Het
Zfp467 A T 6: 48,438,755 V321E probably damaging Het
Other mutations in Slc17a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00920:Slc17a3 APN 13 23856481 missense probably benign 0.20
IGL02569:Slc17a3 APN 13 23846302 missense probably damaging 1.00
IGL02628:Slc17a3 APN 13 23842451 start codon destroyed probably null 1.00
IGL02745:Slc17a3 APN 13 23842486 missense probably benign 0.01
IGL03001:Slc17a3 APN 13 23856784 missense probably damaging 1.00
IGL03143:Slc17a3 APN 13 23855979 splice site probably null
IGL03144:Slc17a3 APN 13 23846440 missense probably benign 0.00
R0052:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0054:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0131:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0131:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0152:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0153:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0233:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0257:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0294:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0295:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0318:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0319:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0352:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0462:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0610:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0627:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0652:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0765:Slc17a3 UTSW 13 23846896 nonsense probably null
R1529:Slc17a3 UTSW 13 23845445 missense probably damaging 1.00
R1532:Slc17a3 UTSW 13 23856500 missense probably damaging 1.00
R1569:Slc17a3 UTSW 13 23855608 missense probably benign 0.09
R1640:Slc17a3 UTSW 13 23852357 nonsense probably null
R1643:Slc17a3 UTSW 13 23857198 splice site probably benign
R1715:Slc17a3 UTSW 13 23856741 missense probably benign 0.19
R2407:Slc17a3 UTSW 13 23852435 critical splice donor site probably null
R2512:Slc17a3 UTSW 13 23846247 missense probably benign 0.13
R3923:Slc17a3 UTSW 13 23858054 missense possibly damaging 0.89
R4449:Slc17a3 UTSW 13 23856732 missense probably damaging 0.99
R5166:Slc17a3 UTSW 13 23842542 critical splice donor site probably null
R5748:Slc17a3 UTSW 13 23856466 missense probably damaging 1.00
R5989:Slc17a3 UTSW 13 23842428 start gained probably benign
R6281:Slc17a3 UTSW 13 23856799 missense probably benign 0.17
R6811:Slc17a3 UTSW 13 23855941 missense possibly damaging 0.61
R7283:Slc17a3 UTSW 13 23855848 missense
R7341:Slc17a3 UTSW 13 23846884 nonsense probably null
R7467:Slc17a3 UTSW 13 23846967 critical splice donor site probably null
R7485:Slc17a3 UTSW 13 23855849 missense
Predicted Primers PCR Primer
(F):5'- TGATTTATGATGACCCTGTCTCTCACCC -3'
(R):5'- ACTGTGACAGATGATGCAAACATGAAGA -3'

Sequencing Primer
(F):5'- TCTCTGAACCAACAGGTACATATAAG -3'
(R):5'- TGATGCAAACATGAAGAAGGAATG -3'
Posted On2013-07-11