Incidental Mutation 'R7647:Gldc'
ID590618
Institutional Source Beutler Lab
Gene Symbol Gldc
Ensembl Gene ENSMUSG00000024827
Gene Nameglycine decarboxylase
SynonymsD030049L12Rik, D19Wsu57e
Accession Numbers

Genbank: NM_138595.1

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7647 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location30098449-30175418 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30118667 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 648 (V648A)
Ref Sequence ENSEMBL: ENSMUSP00000025778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025778]
Predicted Effect probably damaging
Transcript: ENSMUST00000025778
AA Change: V648A

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000025778
Gene: ENSMUSG00000024827
AA Change: V648A

DomainStartEndE-ValueType
low complexity region 5 28 N/A INTRINSIC
low complexity region 33 56 N/A INTRINSIC
Pfam:GDC-P 70 493 1.1e-202 PFAM
low complexity region 504 515 N/A INTRINSIC
Pfam:GDC-P 519 798 6.5e-8 PFAM
Pfam:Beta_elim_lyase 589 745 2e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Degradation of glycine is brought about by the glycine cleavage system, which is composed of four mitochondrial protein components: P protein (a pyridoxal phosphate-dependent glycine decarboxylase), H protein (a lipoic acid-containing protein), T protein (a tetrahydrofolate-requiring enzyme), and L protein (a lipoamide dehydrogenase). The protein encoded by this gene is the P protein, which binds to glycine and enables the methylamine group from glycine to be transferred to the T protein. Defects in this gene are a cause of nonketotic hyperglycinemia (NKH).[provided by RefSeq, Jan 2010]
PHENOTYPE: Hypomorphic mutants show a developmental delay, hyperglycinemia, altered folate profiles, neural tube defects and postnatal lethality, while survivors show hydrocephaly and premature death. Homozygotes for an ENU allele show omphalocele and severe cardiovascular, craniofacial, renal and eye defects. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik C A 12: 18,514,802 T22K possibly damaging Het
9530053A07Rik A G 7: 28,140,045 K428E probably benign Het
Abca7 G T 10: 80,000,822 M344I probably benign Het
Alg14 T C 3: 121,361,685 S185P probably damaging Het
Atg13 A T 2: 91,688,661 H146Q possibly damaging Het
Atmin T G 8: 116,957,922 F774V possibly damaging Het
Ccdc150 A G 1: 54,356,704 D782G probably damaging Het
Ccdc86 A G 19: 10,948,999 S79P unknown Het
Cd180 A T 13: 102,705,943 E499V probably damaging Het
Cd24a C T 10: 43,582,751 H73Y unknown Het
Cdh17 C T 4: 11,814,698 P751L probably damaging Het
Chil3 A G 3: 106,148,806 L344S possibly damaging Het
Cspp1 A G 1: 10,135,937 D1129G probably benign Het
Cyth1 C A 11: 118,177,288 V288L probably benign Het
Ddx19a A T 8: 110,976,627 probably null Het
Dpysl4 T A 7: 139,099,773 Y520N possibly damaging Het
Eif4b T A 15: 102,088,694 M249K unknown Het
Enam G A 5: 88,503,025 D798N probably benign Het
Gm7995 A G 14: 42,311,351 I62V possibly damaging Het
Ice1 A G 13: 70,589,797 V2177A possibly damaging Het
Kdm5a T A 6: 120,427,786 S1330T probably benign Het
Mon2 G T 10: 123,006,026 P1553Q probably benign Het
Mylk G C 16: 34,879,524 S419T probably benign Het
Nphs1 T A 7: 30,481,965 probably null Het
Nsd1 A G 13: 55,299,835 T1924A probably damaging Het
Obscn T A 11: 58,997,287 probably null Het
Olfr323 A T 11: 58,625,203 V281D probably damaging Het
Olfr651 T C 7: 104,553,686 F256L probably benign Het
Olfr782 T C 10: 129,351,457 V298A probably benign Het
Olfr806 A T 10: 129,738,201 C239S probably damaging Het
Pcsk1 A G 13: 75,132,210 D718G possibly damaging Het
Pitrm1 A T 13: 6,555,408 N158I probably damaging Het
Pkd1l1 C T 11: 8,947,296 V538M Het
Prkdc G T 16: 15,737,943 G2194C probably damaging Het
Psmc5 T C 11: 106,261,607 M150T possibly damaging Het
Rint1 T C 5: 23,800,802 Y161H probably damaging Het
Sdk2 T C 11: 113,793,737 K1966R probably damaging Het
Sgcb A T 5: 73,639,377 probably null Het
Slc4a7 G A 14: 14,773,348 E773K probably benign Het
Sp100 A G 1: 85,692,043 K353E possibly damaging Het
Ssh1 T C 5: 113,942,958 T804A probably benign Het
Vipr1 T C 9: 121,653,839 L40P possibly damaging Het
Vmn1r7 A G 6: 57,025,270 S2P probably benign Het
Vwa8 T C 14: 78,935,229 S304P probably damaging Het
Zbed4 T C 15: 88,781,721 M664T probably damaging Het
Other mutations in Gldc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Gldc APN 19 30115240 missense probably damaging 1.00
IGL01016:Gldc APN 19 30133493 missense possibly damaging 0.93
IGL01112:Gldc APN 19 30158513 critical splice donor site probably null
IGL01510:Gldc APN 19 30113721 critical splice donor site probably null
IGL01516:Gldc APN 19 30099032 missense probably damaging 1.00
IGL01598:Gldc APN 19 30133756 missense probably damaging 1.00
IGL01646:Gldc APN 19 30100765 missense possibly damaging 0.61
IGL02024:Gldc APN 19 30100827 missense probably damaging 1.00
IGL02125:Gldc APN 19 30147241 missense probably benign 0.03
IGL02548:Gldc APN 19 30099899 missense probably benign
IGL02711:Gldc APN 19 30145146 critical splice donor site probably null
IGL02818:Gldc APN 19 30136509 missense probably damaging 0.99
IGL02982:Gldc APN 19 30145145 critical splice donor site probably null
IGL03165:Gldc APN 19 30098993 missense possibly damaging 0.61
jojoba UTSW 19 30133512 missense probably damaging 1.00
miserable UTSW 19 30151536 missense probably damaging 1.00
Urchin UTSW 19 30118602 missense probably damaging 0.98
I2289:Gldc UTSW 19 30147176 nonsense probably null
R0180:Gldc UTSW 19 30100817 missense possibly damaging 0.95
R0269:Gldc UTSW 19 30118602 missense probably damaging 0.98
R0277:Gldc UTSW 19 30116451 missense possibly damaging 0.84
R1085:Gldc UTSW 19 30151428 missense probably damaging 1.00
R1159:Gldc UTSW 19 30160762 intron probably benign
R1500:Gldc UTSW 19 30113825 missense possibly damaging 0.88
R1507:Gldc UTSW 19 30118638 missense probably damaging 1.00
R1592:Gldc UTSW 19 30160677 intron probably benign
R1593:Gldc UTSW 19 30113750 missense probably damaging 1.00
R1675:Gldc UTSW 19 30143453 missense probably damaging 1.00
R1869:Gldc UTSW 19 30139332 missense probably benign
R1965:Gldc UTSW 19 30137113 nonsense probably null
R2312:Gldc UTSW 19 30100826 missense probably damaging 0.98
R2425:Gldc UTSW 19 30131790 missense probably damaging 1.00
R3836:Gldc UTSW 19 30118675 splice site probably benign
R3837:Gldc UTSW 19 30118675 splice site probably benign
R3839:Gldc UTSW 19 30118675 splice site probably benign
R4191:Gldc UTSW 19 30145658 missense probably damaging 0.96
R4380:Gldc UTSW 19 30160768 intron probably benign
R4508:Gldc UTSW 19 30143407 missense probably damaging 1.00
R4570:Gldc UTSW 19 30174439 missense probably benign
R4655:Gldc UTSW 19 30160702 intron probably benign
R4842:Gldc UTSW 19 30133732 missense possibly damaging 0.94
R5070:Gldc UTSW 19 30118598 missense possibly damaging 0.84
R5085:Gldc UTSW 19 30151536 missense probably damaging 1.00
R5268:Gldc UTSW 19 30145725 missense probably damaging 0.96
R5368:Gldc UTSW 19 30158521 missense probably benign
R5718:Gldc UTSW 19 30110772 nonsense probably null
R5878:Gldc UTSW 19 30143467 splice site probably null
R6192:Gldc UTSW 19 30133772 missense probably damaging 0.98
R6453:Gldc UTSW 19 30116517 missense probably damaging 0.99
R6777:Gldc UTSW 19 30133512 missense probably damaging 1.00
R6865:Gldc UTSW 19 30133762 missense possibly damaging 0.92
R7332:Gldc UTSW 19 30116526 missense probably damaging 0.99
R7390:Gldc UTSW 19 30099914 missense possibly damaging 0.46
Z1177:Gldc UTSW 19 30110778 missense probably damaging 1.00
Z1177:Gldc UTSW 19 30110779 missense probably damaging 0.99
Z1177:Gldc UTSW 19 30145748 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- ATGACATCACCATCATCTGTCC -3'
(R):5'- ACGGAAATTCCCCTTCAGGAC -3'

Sequencing Primer
(F):5'- CCCTCCCAGCCCAGAGTG -3'
(R):5'- CAGGACATGGTTTTTGCAGTAACC -3'
Posted On2019-10-24