Incidental Mutation 'R7647:Gldc'
ID 590618
Institutional Source Beutler Lab
Gene Symbol Gldc
Ensembl Gene ENSMUSG00000024827
Gene Name glycine decarboxylase
Synonyms b2b2679Clo, D030049L12Rik, D19Wsu57e
MMRRC Submission 045725-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7647 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 30075847-30152829 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 30096067 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 648 (V648A)
Ref Sequence ENSEMBL: ENSMUSP00000025778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025778]
AlphaFold Q91W43
Predicted Effect probably damaging
Transcript: ENSMUST00000025778
AA Change: V648A

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000025778
Gene: ENSMUSG00000024827
AA Change: V648A

DomainStartEndE-ValueType
low complexity region 5 28 N/A INTRINSIC
low complexity region 33 56 N/A INTRINSIC
Pfam:GDC-P 70 493 1.1e-202 PFAM
low complexity region 504 515 N/A INTRINSIC
Pfam:GDC-P 519 798 6.5e-8 PFAM
Pfam:Beta_elim_lyase 589 745 2e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Degradation of glycine is brought about by the glycine cleavage system, which is composed of four mitochondrial protein components: P protein (a pyridoxal phosphate-dependent glycine decarboxylase), H protein (a lipoic acid-containing protein), T protein (a tetrahydrofolate-requiring enzyme), and L protein (a lipoamide dehydrogenase). The protein encoded by this gene is the P protein, which binds to glycine and enables the methylamine group from glycine to be transferred to the T protein. Defects in this gene are a cause of nonketotic hyperglycinemia (NKH).[provided by RefSeq, Jan 2010]
PHENOTYPE: Hypomorphic mutants show a developmental delay, hyperglycinemia, altered folate profiles, neural tube defects and postnatal lethality, while survivors show hydrocephaly and premature death. Homozygotes for an ENU allele show omphalocele and severe cardiovascular, craniofacial, renal and eye defects. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik C A 12: 18,564,803 (GRCm39) T22K possibly damaging Het
Abca7 G T 10: 79,836,656 (GRCm39) M344I probably benign Het
Alg14 T C 3: 121,155,334 (GRCm39) S185P probably damaging Het
Atg13 A T 2: 91,519,006 (GRCm39) H146Q possibly damaging Het
Atmin T G 8: 117,684,661 (GRCm39) F774V possibly damaging Het
Ccdc150 A G 1: 54,395,863 (GRCm39) D782G probably damaging Het
Ccdc86 A G 19: 10,926,363 (GRCm39) S79P unknown Het
Cd180 A T 13: 102,842,451 (GRCm39) E499V probably damaging Het
Cd24a C T 10: 43,458,747 (GRCm39) H73Y unknown Het
Cdh17 C T 4: 11,814,698 (GRCm39) P751L probably damaging Het
Chil3 A G 3: 106,056,122 (GRCm39) L344S possibly damaging Het
Cspp1 A G 1: 10,206,162 (GRCm39) D1129G probably benign Het
Cyth1 C A 11: 118,068,114 (GRCm39) V288L probably benign Het
Ddx19a A T 8: 111,703,259 (GRCm39) probably null Het
Dpysl4 T A 7: 138,679,689 (GRCm39) Y520N possibly damaging Het
Eif4b T A 15: 101,997,129 (GRCm39) M249K unknown Het
Enam G A 5: 88,650,884 (GRCm39) D798N probably benign Het
Fcgbpl1 A G 7: 27,839,470 (GRCm39) K428E probably benign Het
Gm7995 A G 14: 42,133,308 (GRCm39) I62V possibly damaging Het
Ice1 A G 13: 70,737,916 (GRCm39) V2177A possibly damaging Het
Kdm5a T A 6: 120,404,747 (GRCm39) S1330T probably benign Het
Mon2 G T 10: 122,841,931 (GRCm39) P1553Q probably benign Het
Mylk G C 16: 34,699,894 (GRCm39) S419T probably benign Het
Nphs1 T A 7: 30,181,390 (GRCm39) probably null Het
Nsd1 A G 13: 55,447,648 (GRCm39) T1924A probably damaging Het
Obscn T A 11: 58,888,113 (GRCm39) probably null Het
Or11l3 A T 11: 58,516,029 (GRCm39) V281D probably damaging Het
Or52h9 T C 7: 104,202,893 (GRCm39) F256L probably benign Het
Or6c213 A T 10: 129,574,070 (GRCm39) C239S probably damaging Het
Or6c6 T C 10: 129,187,326 (GRCm39) V298A probably benign Het
Pcsk1 A G 13: 75,280,329 (GRCm39) D718G possibly damaging Het
Pitrm1 A T 13: 6,605,444 (GRCm39) N158I probably damaging Het
Pkd1l1 C T 11: 8,897,296 (GRCm39) V538M Het
Prkdc G T 16: 15,555,807 (GRCm39) G2194C probably damaging Het
Psmc5 T C 11: 106,152,433 (GRCm39) M150T possibly damaging Het
Rint1 T C 5: 24,005,800 (GRCm39) Y161H probably damaging Het
Sdk2 T C 11: 113,684,563 (GRCm39) K1966R probably damaging Het
Sgcb A T 5: 73,796,720 (GRCm39) probably null Het
Slc4a7 G A 14: 14,773,348 (GRCm38) E773K probably benign Het
Sp100 A G 1: 85,619,764 (GRCm39) K353E possibly damaging Het
Ssh1 T C 5: 114,081,019 (GRCm39) T804A probably benign Het
Vipr1 T C 9: 121,482,905 (GRCm39) L40P possibly damaging Het
Vmn1r7 A G 6: 57,002,255 (GRCm39) S2P probably benign Het
Vwa8 T C 14: 79,172,669 (GRCm39) S304P probably damaging Het
Zbed4 T C 15: 88,665,924 (GRCm39) M664T probably damaging Het
Other mutations in Gldc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Gldc APN 19 30,092,640 (GRCm39) missense probably damaging 1.00
IGL01016:Gldc APN 19 30,110,893 (GRCm39) missense possibly damaging 0.93
IGL01112:Gldc APN 19 30,135,913 (GRCm39) critical splice donor site probably null
IGL01510:Gldc APN 19 30,091,121 (GRCm39) critical splice donor site probably null
IGL01516:Gldc APN 19 30,076,432 (GRCm39) missense probably damaging 1.00
IGL01598:Gldc APN 19 30,111,156 (GRCm39) missense probably damaging 1.00
IGL01646:Gldc APN 19 30,078,165 (GRCm39) missense possibly damaging 0.61
IGL02024:Gldc APN 19 30,078,227 (GRCm39) missense probably damaging 1.00
IGL02125:Gldc APN 19 30,124,641 (GRCm39) missense probably benign 0.03
IGL02548:Gldc APN 19 30,077,299 (GRCm39) missense probably benign
IGL02711:Gldc APN 19 30,122,546 (GRCm39) critical splice donor site probably null
IGL02818:Gldc APN 19 30,113,909 (GRCm39) missense probably damaging 0.99
IGL02982:Gldc APN 19 30,122,545 (GRCm39) critical splice donor site probably null
IGL03165:Gldc APN 19 30,076,393 (GRCm39) missense possibly damaging 0.61
jojoba UTSW 19 30,110,912 (GRCm39) missense probably damaging 1.00
miserable UTSW 19 30,128,936 (GRCm39) missense probably damaging 1.00
Urchin UTSW 19 30,096,002 (GRCm39) missense probably damaging 0.98
I2289:Gldc UTSW 19 30,124,576 (GRCm39) nonsense probably null
R0180:Gldc UTSW 19 30,078,217 (GRCm39) missense possibly damaging 0.95
R0269:Gldc UTSW 19 30,096,002 (GRCm39) missense probably damaging 0.98
R0277:Gldc UTSW 19 30,093,851 (GRCm39) missense possibly damaging 0.84
R1085:Gldc UTSW 19 30,128,828 (GRCm39) missense probably damaging 1.00
R1159:Gldc UTSW 19 30,138,162 (GRCm39) intron probably benign
R1500:Gldc UTSW 19 30,091,225 (GRCm39) missense possibly damaging 0.88
R1507:Gldc UTSW 19 30,096,038 (GRCm39) missense probably damaging 1.00
R1592:Gldc UTSW 19 30,138,077 (GRCm39) intron probably benign
R1593:Gldc UTSW 19 30,091,150 (GRCm39) missense probably damaging 1.00
R1675:Gldc UTSW 19 30,120,853 (GRCm39) missense probably damaging 1.00
R1869:Gldc UTSW 19 30,116,732 (GRCm39) missense probably benign
R1965:Gldc UTSW 19 30,114,513 (GRCm39) nonsense probably null
R2312:Gldc UTSW 19 30,078,226 (GRCm39) missense probably damaging 0.98
R2425:Gldc UTSW 19 30,109,190 (GRCm39) missense probably damaging 1.00
R3836:Gldc UTSW 19 30,096,075 (GRCm39) splice site probably benign
R3837:Gldc UTSW 19 30,096,075 (GRCm39) splice site probably benign
R3839:Gldc UTSW 19 30,096,075 (GRCm39) splice site probably benign
R4191:Gldc UTSW 19 30,123,058 (GRCm39) missense probably damaging 0.96
R4380:Gldc UTSW 19 30,138,168 (GRCm39) intron probably benign
R4508:Gldc UTSW 19 30,120,807 (GRCm39) missense probably damaging 1.00
R4570:Gldc UTSW 19 30,151,839 (GRCm39) missense probably benign
R4655:Gldc UTSW 19 30,138,102 (GRCm39) intron probably benign
R4842:Gldc UTSW 19 30,111,132 (GRCm39) missense possibly damaging 0.94
R5070:Gldc UTSW 19 30,095,998 (GRCm39) missense possibly damaging 0.84
R5085:Gldc UTSW 19 30,128,936 (GRCm39) missense probably damaging 1.00
R5268:Gldc UTSW 19 30,123,125 (GRCm39) missense probably damaging 0.96
R5368:Gldc UTSW 19 30,135,921 (GRCm39) missense probably benign
R5718:Gldc UTSW 19 30,088,172 (GRCm39) nonsense probably null
R5878:Gldc UTSW 19 30,120,867 (GRCm39) splice site probably null
R6192:Gldc UTSW 19 30,111,172 (GRCm39) missense probably damaging 0.98
R6453:Gldc UTSW 19 30,093,917 (GRCm39) missense probably damaging 0.99
R6777:Gldc UTSW 19 30,110,912 (GRCm39) missense probably damaging 1.00
R6865:Gldc UTSW 19 30,111,162 (GRCm39) missense possibly damaging 0.92
R7332:Gldc UTSW 19 30,093,926 (GRCm39) missense probably damaging 0.99
R7390:Gldc UTSW 19 30,077,314 (GRCm39) missense possibly damaging 0.46
R8081:Gldc UTSW 19 30,135,987 (GRCm39) frame shift probably null
R8171:Gldc UTSW 19 30,111,161 (GRCm39) missense probably benign 0.24
R8321:Gldc UTSW 19 30,120,807 (GRCm39) nonsense probably null
R8374:Gldc UTSW 19 30,114,594 (GRCm39) missense probably damaging 1.00
R8503:Gldc UTSW 19 30,077,254 (GRCm39) missense probably benign 0.26
R8510:Gldc UTSW 19 30,093,905 (GRCm39) missense probably damaging 1.00
R8785:Gldc UTSW 19 30,092,634 (GRCm39) missense probably damaging 1.00
R8818:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8820:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8829:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8830:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8859:Gldc UTSW 19 30,116,779 (GRCm39) missense probably damaging 1.00
R8887:Gldc UTSW 19 30,111,156 (GRCm39) missense possibly damaging 0.94
R8935:Gldc UTSW 19 30,109,093 (GRCm39) missense probably benign 0.00
R8940:Gldc UTSW 19 30,128,884 (GRCm39) missense probably benign
R9070:Gldc UTSW 19 30,080,404 (GRCm39) missense probably damaging 1.00
R9100:Gldc UTSW 19 30,077,314 (GRCm39) missense possibly damaging 0.81
R9144:Gldc UTSW 19 30,114,593 (GRCm39) missense
R9163:Gldc UTSW 19 30,111,686 (GRCm39) missense probably benign 0.13
R9429:Gldc UTSW 19 30,091,172 (GRCm39) missense possibly damaging 0.88
Z1177:Gldc UTSW 19 30,123,148 (GRCm39) missense possibly damaging 0.61
Z1177:Gldc UTSW 19 30,088,179 (GRCm39) missense probably damaging 0.99
Z1177:Gldc UTSW 19 30,088,178 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGACATCACCATCATCTGTCC -3'
(R):5'- ACGGAAATTCCCCTTCAGGAC -3'

Sequencing Primer
(F):5'- CCCTCCCAGCCCAGAGTG -3'
(R):5'- CAGGACATGGTTTTTGCAGTAACC -3'
Posted On 2019-10-24