Incidental Mutation 'R7648:Mndal'
ID590622
Institutional Source Beutler Lab
Gene Symbol Mndal
Ensembl Gene ENSMUSG00000090272
Gene Namemyeloid nuclear differentiation antigen like
SynonymsGm2785
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R7648 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location173849126-173942491 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 173857395 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 536 (Y536F)
Ref Sequence ENSEMBL: ENSMUSP00000140610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111210] [ENSMUST00000186442] [ENSMUST00000188804]
Predicted Effect probably benign
Transcript: ENSMUST00000111210
AA Change: Y536F

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000106841
Gene: ENSMUSG00000090272
AA Change: Y536F

DomainStartEndE-ValueType
PYRIN 5 83 3.71e-20 SMART
internal_repeat_1 152 166 2.38e-7 PROSPERO
low complexity region 170 200 N/A INTRINSIC
internal_repeat_1 208 222 2.38e-7 PROSPERO
low complexity region 225 249 N/A INTRINSIC
low complexity region 276 292 N/A INTRINSIC
low complexity region 294 305 N/A INTRINSIC
Pfam:HIN 311 479 3.4e-76 PFAM
low complexity region 497 507 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000186442
AA Change: Y483F
SMART Domains Protein: ENSMUSP00000140539
Gene: ENSMUSG00000090272
AA Change: Y483F

DomainStartEndE-ValueType
PYRIN 5 83 1.8e-24 SMART
internal_repeat_1 152 166 4.72e-7 PROSPERO
low complexity region 170 200 N/A INTRINSIC
internal_repeat_1 208 222 4.72e-7 PROSPERO
low complexity region 225 237 N/A INTRINSIC
low complexity region 239 250 N/A INTRINSIC
Pfam:HIN 258 427 2.9e-83 PFAM
low complexity region 444 454 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188804
AA Change: Y536F

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000140610
Gene: ENSMUSG00000090272
AA Change: Y536F

DomainStartEndE-ValueType
PYRIN 5 83 3.71e-20 SMART
internal_repeat_1 152 166 2.38e-7 PROSPERO
low complexity region 170 200 N/A INTRINSIC
internal_repeat_1 208 222 2.38e-7 PROSPERO
low complexity region 225 249 N/A INTRINSIC
low complexity region 276 292 N/A INTRINSIC
low complexity region 294 305 N/A INTRINSIC
Pfam:HIN 311 480 4.3e-86 PFAM
low complexity region 497 507 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T C 7: 41,612,462 V46A possibly damaging Het
Asb13 C A 13: 3,649,332 N177K probably damaging Het
Asprv1 A G 6: 86,628,870 T233A probably damaging Het
Atad2b T A 12: 5,027,182 probably null Het
Atxn2 G T 5: 121,796,377 V880F probably damaging Het
Car14 T C 3: 95,898,195 N322S probably benign Het
Cdc42bpb T C 12: 111,377,153 E40G probably damaging Het
Ceacam16 G T 7: 19,852,278 A103E unknown Het
Cnnm2 A G 19: 46,877,900 D829G probably damaging Het
Cpt1b C T 15: 89,421,367 A382T probably damaging Het
Crygc A G 1: 65,073,325 F30S probably damaging Het
Cstf2t A G 19: 31,083,592 Q176R possibly damaging Het
Ctif A T 18: 75,637,142 H57Q probably benign Het
Cyp2c40 A G 19: 39,803,845 *195Q probably null Het
Cyp2j8 T A 4: 96,499,603 D207V probably damaging Het
Ddx49 A G 8: 70,297,955 V123A possibly damaging Het
E4f1 A T 17: 24,445,448 I456K probably benign Het
Eif4b T C 15: 102,089,000 S317P unknown Het
Enam A T 5: 88,504,157 Q1175L possibly damaging Het
Eppk1 T C 15: 76,110,671 Y670C probably benign Het
Fam163b G T 2: 27,112,740 Q82K probably benign Het
Fam193a A T 5: 34,431,182 K358N probably damaging Het
Gls C A 1: 52,196,780 R392L probably damaging Het
Gm12569 G A 11: 51,234,786 E179K possibly damaging Het
Gramd1c A G 16: 43,989,869 V247A probably damaging Het
Gucy1a1 C T 3: 82,108,707 E325K possibly damaging Het
Hectd4 T C 5: 121,254,371 C233R possibly damaging Het
Ice1 A G 13: 70,589,797 V2177A possibly damaging Het
Kif28 A G 1: 179,709,424 V498A possibly damaging Het
Klhdc7a T C 4: 139,965,939 S566G possibly damaging Het
Mlph G A 1: 90,933,526 probably null Het
Mrgpra2a A T 7: 47,426,663 C282* probably null Het
Msh3 A T 13: 92,274,028 I684N probably damaging Het
Mylk G C 16: 34,879,524 S419T probably benign Het
Nfxl1 T C 5: 72,523,536 K747R probably benign Het
Nup98 T G 7: 102,124,197 H1641P possibly damaging Het
Olfr881 A C 9: 37,992,560 T18P probably damaging Het
Pcm1 A G 8: 41,275,699 N570D probably damaging Het
Plekhh1 T A 12: 79,055,131 V325E probably benign Het
Rabl3 A T 16: 37,563,758 I176F probably damaging Het
Relb T C 7: 19,619,842 E37G possibly damaging Het
Slc4a7 G A 14: 14,773,348 E773K probably benign Het
Tars2 G A 3: 95,750,982 T177I probably benign Het
Tenm2 T A 11: 36,106,736 N842I probably damaging Het
Tmem175 A G 5: 108,644,566 E236G possibly damaging Het
Trank1 A G 9: 111,391,685 T2497A probably benign Het
Trf A G 9: 103,227,969 V48A probably benign Het
Ttc28 A G 5: 111,183,392 K493E possibly damaging Het
Unc50 T C 1: 37,431,321 S9P probably benign Het
Uso1 T A 5: 92,194,002 probably null Het
Usp49 A T 17: 47,674,828 N487I possibly damaging Het
Xab2 T C 8: 3,610,638 D768G probably benign Het
Xcr1 T C 9: 123,856,592 E35G possibly damaging Het
Other mutations in Mndal
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01363:Mndal APN 1 173857456 missense possibly damaging 0.68
IGL02309:Mndal APN 1 173874455 missense probably damaging 0.98
IGL02559:Mndal APN 1 173872920 missense probably benign 0.06
IGL02637:Mndal APN 1 173857437 missense possibly damaging 0.63
LCD18:Mndal UTSW 1 173880218 unclassified probably benign
R0076:Mndal UTSW 1 173874447 nonsense probably null
R0123:Mndal UTSW 1 173857513 splice site probably benign
R0134:Mndal UTSW 1 173857513 splice site probably benign
R0225:Mndal UTSW 1 173857513 splice site probably benign
R0976:Mndal UTSW 1 173862845 missense possibly damaging 0.70
R1081:Mndal UTSW 1 173860222 missense probably benign 0.01
R1497:Mndal UTSW 1 173872875 missense probably benign 0.04
R1522:Mndal UTSW 1 173871466 missense possibly damaging 0.68
R1630:Mndal UTSW 1 173874392 missense possibly damaging 0.52
R1874:Mndal UTSW 1 173860367 unclassified probably benign
R4183:Mndal UTSW 1 173875771 missense possibly damaging 0.95
R4544:Mndal UTSW 1 173875664 nonsense probably null
R4545:Mndal UTSW 1 173875664 nonsense probably null
R4907:Mndal UTSW 1 173862690 missense probably damaging 0.99
R5066:Mndal UTSW 1 173875663 missense probably damaging 1.00
R5853:Mndal UTSW 1 173862504 missense probably damaging 0.98
R6208:Mndal UTSW 1 173857422 missense possibly damaging 0.84
R6395:Mndal UTSW 1 173871433 missense possibly damaging 0.73
R6923:Mndal UTSW 1 173884698 splice site probably null
R6933:Mndal UTSW 1 173875683 missense probably damaging 1.00
R7030:Mndal UTSW 1 173875594 missense probably damaging 1.00
R7327:Mndal UTSW 1 173875619 missense unknown
R8130:Mndal UTSW 1 173871545 nonsense probably null
R8514:Mndal UTSW 1 173860192 missense possibly damaging 0.84
Z1177:Mndal UTSW 1 173874404 missense unknown
Predicted Primers PCR Primer
(F):5'- ACACAGCACTATATAATGATGTCCC -3'
(R):5'- TGGCCCTTGAGTGGAATAGG -3'

Sequencing Primer
(F):5'- GATGTCCCTTTAAAAAGACATG -3'
(R):5'- CCCTTGAGTGGAATAGGCAAGG -3'
Posted On2019-10-24