Incidental Mutation 'R7648:Ttc28'
ID590634
Institutional Source Beutler Lab
Gene Symbol Ttc28
Ensembl Gene ENSMUSG00000033209
Gene Nametetratricopeptide repeat domain 28
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7648 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location110879803-111289780 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111183392 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 493 (K493E)
Ref Sequence ENSEMBL: ENSMUSP00000136116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040111] [ENSMUST00000156290]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040111
AA Change: K493E

PolyPhen 2 Score 0.516 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000136116
Gene: ENSMUSG00000033209
AA Change: K493E

DomainStartEndE-ValueType
low complexity region 4 28 N/A INTRINSIC
TPR 52 85 2.84e1 SMART
TPR 86 119 5.03e-1 SMART
TPR 120 153 2.11e-3 SMART
TPR 268 301 8.51e0 SMART
TPR 339 372 1.78e-1 SMART
TPR 379 412 2.82e-4 SMART
TPR 419 452 9.98e-5 SMART
TPR 459 492 1.88e0 SMART
TPR 499 532 1.11e1 SMART
TPR 539 572 2.93e-2 SMART
TPR 579 612 1.21e-3 SMART
TPR 619 652 4.91e-4 SMART
TPR 659 692 7.56e-5 SMART
TPR 699 732 8.29e0 SMART
TPR 739 772 1.63e0 SMART
TPR 779 812 1.24e0 SMART
TPR 819 852 7.98e-4 SMART
TPR 859 892 8.74e0 SMART
TPR 902 935 5.43e-6 SMART
TPR 942 975 4.09e-1 SMART
TPR 982 1015 9.98e-5 SMART
TPR 1022 1055 7.12e-1 SMART
TPR 1062 1095 5.69e0 SMART
TPR 1102 1135 3.14e-2 SMART
TPR 1142 1175 2.84e1 SMART
low complexity region 1259 1277 N/A INTRINSIC
Pfam:CHAT 1415 1738 7.3e-77 PFAM
low complexity region 1972 1990 N/A INTRINSIC
low complexity region 2014 2031 N/A INTRINSIC
low complexity region 2033 2045 N/A INTRINSIC
low complexity region 2155 2171 N/A INTRINSIC
low complexity region 2283 2293 N/A INTRINSIC
low complexity region 2327 2352 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000156290
AA Change: K462E

PolyPhen 2 Score 0.561 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000137609
Gene: ENSMUSG00000033209
AA Change: K462E

DomainStartEndE-ValueType
low complexity region 4 28 N/A INTRINSIC
TPR 52 85 2.84e1 SMART
TPR 86 119 5.03e-1 SMART
TPR 120 153 2.11e-3 SMART
TPR 268 301 8.51e0 SMART
TPR 308 341 1.78e-1 SMART
TPR 348 381 2.82e-4 SMART
TPR 388 421 9.98e-5 SMART
TPR 428 461 1.88e0 SMART
TPR 468 501 1.11e1 SMART
TPR 508 541 2.93e-2 SMART
TPR 548 581 1.21e-3 SMART
TPR 588 621 4.91e-4 SMART
TPR 628 661 7.56e-5 SMART
TPR 668 701 8.29e0 SMART
TPR 708 741 1.63e0 SMART
TPR 748 781 1.24e0 SMART
TPR 788 821 7.98e-4 SMART
TPR 828 861 8.74e0 SMART
TPR 871 904 5.43e-6 SMART
TPR 911 944 4.09e-1 SMART
TPR 951 984 9.98e-5 SMART
TPR 991 1024 7.12e-1 SMART
TPR 1031 1064 5.69e0 SMART
TPR 1071 1104 3.14e-2 SMART
TPR 1111 1144 2.84e1 SMART
low complexity region 1228 1246 N/A INTRINSIC
Pfam:CHAT 1384 1707 1.1e-76 PFAM
low complexity region 1941 1959 N/A INTRINSIC
low complexity region 1983 2000 N/A INTRINSIC
low complexity region 2002 2014 N/A INTRINSIC
low complexity region 2124 2140 N/A INTRINSIC
low complexity region 2252 2262 N/A INTRINSIC
low complexity region 2296 2321 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T C 7: 41,612,462 V46A possibly damaging Het
Asb13 C A 13: 3,649,332 N177K probably damaging Het
Asprv1 A G 6: 86,628,870 T233A probably damaging Het
Atad2b T A 12: 5,027,182 probably null Het
Atxn2 G T 5: 121,796,377 V880F probably damaging Het
Car14 T C 3: 95,898,195 N322S probably benign Het
Cdc42bpb T C 12: 111,377,153 E40G probably damaging Het
Ceacam16 G T 7: 19,852,278 A103E unknown Het
Cnnm2 A G 19: 46,877,900 D829G probably damaging Het
Cpt1b C T 15: 89,421,367 A382T probably damaging Het
Crygc A G 1: 65,073,325 F30S probably damaging Het
Cstf2t A G 19: 31,083,592 Q176R possibly damaging Het
Ctif A T 18: 75,637,142 H57Q probably benign Het
Cyp2c40 A G 19: 39,803,845 *195Q probably null Het
Cyp2j8 T A 4: 96,499,603 D207V probably damaging Het
Ddx49 A G 8: 70,297,955 V123A possibly damaging Het
E4f1 A T 17: 24,445,448 I456K probably benign Het
Eif4b T C 15: 102,089,000 S317P unknown Het
Enam A T 5: 88,504,157 Q1175L possibly damaging Het
Eppk1 T C 15: 76,110,671 Y670C probably benign Het
Fam163b G T 2: 27,112,740 Q82K probably benign Het
Fam193a A T 5: 34,431,182 K358N probably damaging Het
Gls C A 1: 52,196,780 R392L probably damaging Het
Gm12569 G A 11: 51,234,786 E179K possibly damaging Het
Gramd1c A G 16: 43,989,869 V247A probably damaging Het
Gucy1a1 C T 3: 82,108,707 E325K possibly damaging Het
Hectd4 T C 5: 121,254,371 C233R possibly damaging Het
Ice1 A G 13: 70,589,797 V2177A possibly damaging Het
Kif28 A G 1: 179,709,424 V498A possibly damaging Het
Klhdc7a T C 4: 139,965,939 S566G possibly damaging Het
Mlph G A 1: 90,933,526 probably null Het
Mndal T A 1: 173,857,395 Y536F probably benign Het
Mrgpra2a A T 7: 47,426,663 C282* probably null Het
Msh3 A T 13: 92,274,028 I684N probably damaging Het
Mylk G C 16: 34,879,524 S419T probably benign Het
Nfxl1 T C 5: 72,523,536 K747R probably benign Het
Nup98 T G 7: 102,124,197 H1641P possibly damaging Het
Olfr881 A C 9: 37,992,560 T18P probably damaging Het
Pcm1 A G 8: 41,275,699 N570D probably damaging Het
Plekhh1 T A 12: 79,055,131 V325E probably benign Het
Rabl3 A T 16: 37,563,758 I176F probably damaging Het
Relb T C 7: 19,619,842 E37G possibly damaging Het
Slc4a7 G A 14: 14,773,348 E773K probably benign Het
Tars2 G A 3: 95,750,982 T177I probably benign Het
Tenm2 T A 11: 36,106,736 N842I probably damaging Het
Tmem175 A G 5: 108,644,566 E236G possibly damaging Het
Trank1 A G 9: 111,391,685 T2497A probably benign Het
Trf A G 9: 103,227,969 V48A probably benign Het
Unc50 T C 1: 37,431,321 S9P probably benign Het
Uso1 T A 5: 92,194,002 probably null Het
Usp49 A T 17: 47,674,828 N487I possibly damaging Het
Xab2 T C 8: 3,610,638 D768G probably benign Het
Xcr1 T C 9: 123,856,592 E35G possibly damaging Het
Other mutations in Ttc28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Ttc28 APN 5 111225688 missense probably damaging 1.00
IGL00963:Ttc28 APN 5 111286389 nonsense probably null
IGL00969:Ttc28 APN 5 111225740 missense probably benign 0.00
IGL01366:Ttc28 APN 5 111085171 critical splice donor site probably null
IGL01528:Ttc28 APN 5 111101960 splice site probably benign
IGL01558:Ttc28 APN 5 111283962 missense probably damaging 0.99
IGL01973:Ttc28 APN 5 111224235 missense possibly damaging 0.88
IGL02040:Ttc28 APN 5 110892936 nonsense probably null
IGL02432:Ttc28 APN 5 111223235 missense probably damaging 1.00
IGL02531:Ttc28 APN 5 111225850 missense probably damaging 1.00
IGL02819:Ttc28 APN 5 111266583 missense probably benign
IGL02830:Ttc28 APN 5 111286239 missense probably benign 0.10
IGL02893:Ttc28 APN 5 111285385 missense possibly damaging 0.87
IGL03387:Ttc28 APN 5 111233342 missense probably benign 0.07
PIT4131001:Ttc28 UTSW 5 110892853 missense probably benign 0.00
R0142:Ttc28 UTSW 5 111277457 missense probably benign 0.40
R0166:Ttc28 UTSW 5 111225634 missense probably benign 0.01
R0328:Ttc28 UTSW 5 111284067 splice site probably benign
R0582:Ttc28 UTSW 5 111183296 missense probably damaging 1.00
R0744:Ttc28 UTSW 5 111231081 missense probably damaging 1.00
R0811:Ttc28 UTSW 5 111235500 missense probably benign 0.24
R0812:Ttc28 UTSW 5 111235500 missense probably benign 0.24
R0828:Ttc28 UTSW 5 111223446 missense probably damaging 1.00
R0833:Ttc28 UTSW 5 111231081 missense probably damaging 1.00
R1013:Ttc28 UTSW 5 111276965 missense probably benign 0.01
R1168:Ttc28 UTSW 5 111231111 missense probably damaging 1.00
R1194:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1195:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1195:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1195:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1196:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1205:Ttc28 UTSW 5 111285769 missense probably benign 0.04
R1386:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1467:Ttc28 UTSW 5 111285388 missense probably benign 0.00
R1467:Ttc28 UTSW 5 111285388 missense probably benign 0.00
R1537:Ttc28 UTSW 5 111285318 missense probably damaging 0.96
R1539:Ttc28 UTSW 5 111100811 missense possibly damaging 0.77
R1558:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1560:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1561:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1566:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1768:Ttc28 UTSW 5 111277168 missense possibly damaging 0.77
R1775:Ttc28 UTSW 5 111276811 missense probably benign 0.00
R1909:Ttc28 UTSW 5 111284054 critical splice donor site probably null
R1911:Ttc28 UTSW 5 111280750 missense possibly damaging 0.93
R1970:Ttc28 UTSW 5 111235635 missense probably benign 0.00
R1990:Ttc28 UTSW 5 111276322 missense probably benign 0.37
R1992:Ttc28 UTSW 5 111276322 missense probably benign 0.37
R2066:Ttc28 UTSW 5 111225933 missense probably benign 0.01
R2112:Ttc28 UTSW 5 111276273 missense probably damaging 0.99
R2158:Ttc28 UTSW 5 111177617 intron probably benign
R2192:Ttc28 UTSW 5 111223496 missense probably damaging 0.99
R2267:Ttc28 UTSW 5 111226003 missense possibly damaging 0.75
R2384:Ttc28 UTSW 5 111276208 missense possibly damaging 0.95
R2989:Ttc28 UTSW 5 111224015 missense probably benign 0.29
R3881:Ttc28 UTSW 5 111183240 missense probably damaging 1.00
R3919:Ttc28 UTSW 5 111285379 missense possibly damaging 0.80
R4455:Ttc28 UTSW 5 111224058 frame shift probably null
R4456:Ttc28 UTSW 5 111224058 frame shift probably null
R4522:Ttc28 UTSW 5 111280172 missense probably benign 0.01
R4548:Ttc28 UTSW 5 111271224 missense possibly damaging 0.86
R4591:Ttc28 UTSW 5 111223281 missense probably damaging 1.00
R4633:Ttc28 UTSW 5 111224001 missense probably damaging 1.00
R4700:Ttc28 UTSW 5 111277043 missense probably damaging 1.00
R4714:Ttc28 UTSW 5 111285229 missense possibly damaging 0.65
R4790:Ttc28 UTSW 5 111224217 missense possibly damaging 0.94
R4803:Ttc28 UTSW 5 111277463 missense possibly damaging 0.90
R4840:Ttc28 UTSW 5 111286081 missense probably damaging 1.00
R4969:Ttc28 UTSW 5 111276255 missense probably damaging 0.96
R5019:Ttc28 UTSW 5 111102064 missense possibly damaging 0.47
R5130:Ttc28 UTSW 5 110892856 missense probably benign
R5150:Ttc28 UTSW 5 111225689 missense probably damaging 1.00
R5214:Ttc28 UTSW 5 111177623 intron probably benign
R5254:Ttc28 UTSW 5 111271238 missense probably benign 0.01
R5518:Ttc28 UTSW 5 111225928 missense probably benign 0.17
R5851:Ttc28 UTSW 5 111235469 splice site probably benign
R5931:Ttc28 UTSW 5 111085109 missense possibly damaging 0.81
R6011:Ttc28 UTSW 5 111286443 missense probably benign
R6176:Ttc28 UTSW 5 111223985 missense probably damaging 1.00
R6221:Ttc28 UTSW 5 111271248 missense probably benign 0.00
R6398:Ttc28 UTSW 5 111276276 missense probably damaging 1.00
R6717:Ttc28 UTSW 5 111285436 missense probably benign
R6770:Ttc28 UTSW 5 111286140 missense probably damaging 1.00
R6901:Ttc28 UTSW 5 111277025 missense possibly damaging 0.88
R7038:Ttc28 UTSW 5 111266579 missense probably benign 0.09
R7073:Ttc28 UTSW 5 111223416 missense possibly damaging 0.96
R7101:Ttc28 UTSW 5 111085092 missense probably damaging 1.00
R7135:Ttc28 UTSW 5 111280007 missense probably damaging 1.00
R7350:Ttc28 UTSW 5 111226037 missense probably damaging 0.97
R7454:Ttc28 UTSW 5 111285484 missense probably benign 0.19
R7461:Ttc28 UTSW 5 111224129 missense probably damaging 1.00
R7596:Ttc28 UTSW 5 111280124 missense probably damaging 1.00
R7613:Ttc28 UTSW 5 111224129 missense probably damaging 1.00
R7625:Ttc28 UTSW 5 111285219 missense possibly damaging 0.65
R7735:Ttc28 UTSW 5 111266678 splice site probably null
R8030:Ttc28 UTSW 5 111286056 missense possibly damaging 0.81
V8831:Ttc28 UTSW 5 111100712 missense probably benign 0.11
Z1088:Ttc28 UTSW 5 111286315 missense probably benign 0.00
Z1176:Ttc28 UTSW 5 111266566 missense possibly damaging 0.59
Z1177:Ttc28 UTSW 5 111278586 missense probably damaging 1.00
Z1177:Ttc28 UTSW 5 111285739 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- GAGGAACTTTGACAAGGCCATG -3'
(R):5'- TTCTCAGAGCACAGAAGAGACAATG -3'

Sequencing Primer
(F):5'- GCCATGTCCTACCACAACTGTG -3'
(R):5'- AGACAATGTGCTTTGCAGTAGGC -3'
Posted On2019-10-24