Incidental Mutation 'R7648:Mrgpra2a'
ID590641
Institutional Source Beutler Lab
Gene Symbol Mrgpra2a
Ensembl Gene ENSMUSG00000093973
Gene NameMAS-related GPR, member A2A
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R7648 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location47426328-47452139 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 47426663 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 282 (C282*)
Ref Sequence ENSEMBL: ENSMUSP00000124631 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159004]
Predicted Effect probably null
Transcript: ENSMUST00000159004
AA Change: C282*
SMART Domains Protein: ENSMUSP00000124631
Gene: ENSMUSG00000093973
AA Change: C282*

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
Pfam:7tm_1 56 222 1.3e-9 PFAM
Pfam:7tm_1 221 288 6.5e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T C 7: 41,612,462 V46A possibly damaging Het
Asb13 C A 13: 3,649,332 N177K probably damaging Het
Asprv1 A G 6: 86,628,870 T233A probably damaging Het
Atad2b T A 12: 5,027,182 probably null Het
Atxn2 G T 5: 121,796,377 V880F probably damaging Het
Car14 T C 3: 95,898,195 N322S probably benign Het
Cdc42bpb T C 12: 111,377,153 E40G probably damaging Het
Ceacam16 G T 7: 19,852,278 A103E unknown Het
Cnnm2 A G 19: 46,877,900 D829G probably damaging Het
Cpt1b C T 15: 89,421,367 A382T probably damaging Het
Crygc A G 1: 65,073,325 F30S probably damaging Het
Cstf2t A G 19: 31,083,592 Q176R possibly damaging Het
Ctif A T 18: 75,637,142 H57Q probably benign Het
Cyp2c40 A G 19: 39,803,845 *195Q probably null Het
Cyp2j8 T A 4: 96,499,603 D207V probably damaging Het
Ddx49 A G 8: 70,297,955 V123A possibly damaging Het
E4f1 A T 17: 24,445,448 I456K probably benign Het
Eif4b T C 15: 102,089,000 S317P unknown Het
Enam A T 5: 88,504,157 Q1175L possibly damaging Het
Eppk1 T C 15: 76,110,671 Y670C probably benign Het
Fam163b G T 2: 27,112,740 Q82K probably benign Het
Fam193a A T 5: 34,431,182 K358N probably damaging Het
Gls C A 1: 52,196,780 R392L probably damaging Het
Gm12569 G A 11: 51,234,786 E179K possibly damaging Het
Gramd1c A G 16: 43,989,869 V247A probably damaging Het
Gucy1a1 C T 3: 82,108,707 E325K possibly damaging Het
Hectd4 T C 5: 121,254,371 C233R possibly damaging Het
Ice1 A G 13: 70,589,797 V2177A possibly damaging Het
Kif28 A G 1: 179,709,424 V498A possibly damaging Het
Klhdc7a T C 4: 139,965,939 S566G possibly damaging Het
Mlph G A 1: 90,933,526 probably null Het
Mndal T A 1: 173,857,395 Y536F probably benign Het
Msh3 A T 13: 92,274,028 I684N probably damaging Het
Mylk G C 16: 34,879,524 S419T probably benign Het
Nfxl1 T C 5: 72,523,536 K747R probably benign Het
Nup98 T G 7: 102,124,197 H1641P possibly damaging Het
Olfr881 A C 9: 37,992,560 T18P probably damaging Het
Pcm1 A G 8: 41,275,699 N570D probably damaging Het
Plekhh1 T A 12: 79,055,131 V325E probably benign Het
Rabl3 A T 16: 37,563,758 I176F probably damaging Het
Relb T C 7: 19,619,842 E37G possibly damaging Het
Slc4a7 G A 14: 14,773,348 E773K probably benign Het
Tars2 G A 3: 95,750,982 T177I probably benign Het
Tenm2 T A 11: 36,106,736 N842I probably damaging Het
Tmem175 A G 5: 108,644,566 E236G possibly damaging Het
Trank1 A G 9: 111,391,685 T2497A probably benign Het
Trf A G 9: 103,227,969 V48A probably benign Het
Ttc28 A G 5: 111,183,392 K493E possibly damaging Het
Unc50 T C 1: 37,431,321 S9P probably benign Het
Uso1 T A 5: 92,194,002 probably null Het
Usp49 A T 17: 47,674,828 N487I possibly damaging Het
Xab2 T C 8: 3,610,638 D768G probably benign Het
Xcr1 T C 9: 123,856,592 E35G possibly damaging Het
Other mutations in Mrgpra2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Mrgpra2a APN 7 47426538 missense probably damaging 0.96
R1487:Mrgpra2a UTSW 7 47426686 missense probably benign 0.29
R1960:Mrgpra2a UTSW 7 47427235 missense probably benign 0.07
R2845:Mrgpra2a UTSW 7 47427130 missense probably benign 0.01
R4756:Mrgpra2a UTSW 7 47427366 missense possibly damaging 0.86
R4910:Mrgpra2a UTSW 7 47426544 missense probably benign 0.00
R5654:Mrgpra2a UTSW 7 47427405 missense probably benign 0.01
R6483:Mrgpra2a UTSW 7 47426689 missense probably benign 0.01
R7136:Mrgpra2a UTSW 7 47427186 missense probably benign 0.03
R7139:Mrgpra2a UTSW 7 47426589 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGACAGTGGTCAAGTGCAG -3'
(R):5'- CAGATGAAGCTTACCAGATTTCATG -3'

Sequencing Primer
(F):5'- CCACCTCTGAGATCCAGGTAGAG -3'
(R):5'- GAAGCTTACCAGATTTCATGTGACC -3'
Posted On2019-10-24