Incidental Mutation 'R7648:Tenm2'
ID 590650
Institutional Source Beutler Lab
Gene Symbol Tenm2
Ensembl Gene ENSMUSG00000049336
Gene Name teneurin transmembrane protein 2
Synonyms D3Bwg1534e, Odz2, 9330187F13Rik, Ten-m2, 2610040L17Rik
MMRRC Submission 045726-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.569) question?
Stock # R7648 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 35897483-37126791 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 35997563 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 842 (N842I)
Ref Sequence ENSEMBL: ENSMUSP00000052014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057207] [ENSMUST00000102801] [ENSMUST00000163524]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000057207
AA Change: N842I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000052014
Gene: ENSMUSG00000049336
AA Change: N842I

DomainStartEndE-ValueType
Pfam:Ten_N 10 374 4.9e-177 PFAM
transmembrane domain 375 397 N/A INTRINSIC
EGF 575 603 5.62e0 SMART
EGF_like 606 634 4.93e1 SMART
EGF 639 668 1.76e1 SMART
EGF 671 700 1.43e-1 SMART
EGF 705 735 1.2e1 SMART
EGF 738 766 9.63e0 SMART
EGF 769 797 1.25e1 SMART
EGF 800 832 1.4e0 SMART
low complexity region 1459 1475 N/A INTRINSIC
low complexity region 2219 2230 N/A INTRINSIC
Pfam:Tox-GHH 2681 2758 1.4e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102801
AA Change: N841I

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099865
Gene: ENSMUSG00000049336
AA Change: N841I

DomainStartEndE-ValueType
Pfam:Ten_N 9 374 2e-186 PFAM
transmembrane domain 375 397 N/A INTRINSIC
EGF 575 603 5.62e0 SMART
EGF_like 606 634 4.93e1 SMART
EGF 639 668 1.76e1 SMART
EGF 671 700 1.43e-1 SMART
EGF 705 735 1.2e1 SMART
EGF 737 765 9.63e0 SMART
EGF 768 796 1.25e1 SMART
EGF 799 831 1.4e0 SMART
low complexity region 1458 1474 N/A INTRINSIC
low complexity region 2218 2229 N/A INTRINSIC
Pfam:Tox-GHH 2679 2757 2e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163524
AA Change: N841I

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129951
Gene: ENSMUSG00000049336
AA Change: N841I

DomainStartEndE-ValueType
Pfam:Ten_N 9 374 2e-186 PFAM
transmembrane domain 375 397 N/A INTRINSIC
EGF 575 603 5.62e0 SMART
EGF_like 606 634 4.93e1 SMART
EGF 639 668 1.76e1 SMART
EGF 671 700 1.43e-1 SMART
EGF 705 735 1.2e1 SMART
EGF 737 765 9.63e0 SMART
EGF 768 796 1.25e1 SMART
EGF 799 831 1.4e0 SMART
low complexity region 1458 1474 N/A INTRINSIC
low complexity region 2218 2229 N/A INTRINSIC
Pfam:Tox-GHH 2679 2757 2e-34 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (53/53)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele show abnormalities in the laterality and mapping of ipsilateral retinal projections that lead to loss of ipsilateral drive, defects in binocular vision, and impaired performance on a visual discrimination task. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T C 7: 41,261,886 (GRCm39) V46A possibly damaging Het
Asb13 C A 13: 3,699,332 (GRCm39) N177K probably damaging Het
Asprv1 A G 6: 86,605,852 (GRCm39) T233A probably damaging Het
Atad2b T A 12: 5,077,182 (GRCm39) probably null Het
Atxn2 G T 5: 121,934,440 (GRCm39) V880F probably damaging Het
Car14 T C 3: 95,805,507 (GRCm39) N322S probably benign Het
Cdc42bpb T C 12: 111,343,587 (GRCm39) E40G probably damaging Het
Ceacam16 G T 7: 19,586,203 (GRCm39) A103E unknown Het
Cnnm2 A G 19: 46,866,339 (GRCm39) D829G probably damaging Het
Cpt1b C T 15: 89,305,570 (GRCm39) A382T probably damaging Het
Crygc A G 1: 65,112,484 (GRCm39) F30S probably damaging Het
Cstf2t A G 19: 31,060,992 (GRCm39) Q176R possibly damaging Het
Ctif A T 18: 75,770,213 (GRCm39) H57Q probably benign Het
Cyp2c40 A G 19: 39,792,289 (GRCm39) *195Q probably null Het
Cyp2j8 T A 4: 96,387,840 (GRCm39) D207V probably damaging Het
Ddx49 A G 8: 70,750,605 (GRCm39) V123A possibly damaging Het
E4f1 A T 17: 24,664,422 (GRCm39) I456K probably benign Het
Eif4b T C 15: 101,997,435 (GRCm39) S317P unknown Het
Enam A T 5: 88,652,016 (GRCm39) Q1175L possibly damaging Het
Eppk1 T C 15: 75,994,871 (GRCm39) Y670C probably benign Het
Fam163b G T 2: 27,002,752 (GRCm39) Q82K probably benign Het
Fam193a A T 5: 34,588,526 (GRCm39) K358N probably damaging Het
Gls C A 1: 52,235,939 (GRCm39) R392L probably damaging Het
Gramd1c A G 16: 43,810,232 (GRCm39) V247A probably damaging Het
Gucy1a1 C T 3: 82,016,014 (GRCm39) E325K possibly damaging Het
Hectd4 T C 5: 121,392,434 (GRCm39) C233R possibly damaging Het
Ice1 A G 13: 70,737,916 (GRCm39) V2177A possibly damaging Het
Kif28 A G 1: 179,536,989 (GRCm39) V498A possibly damaging Het
Klhdc7a T C 4: 139,693,250 (GRCm39) S566G possibly damaging Het
Mlph G A 1: 90,861,248 (GRCm39) probably null Het
Mndal T A 1: 173,684,961 (GRCm39) Y536F probably benign Het
Mrgpra2a A T 7: 47,076,411 (GRCm39) C282* probably null Het
Msantd5 G A 11: 51,125,613 (GRCm39) E179K possibly damaging Het
Msh3 A T 13: 92,410,536 (GRCm39) I684N probably damaging Het
Mylk G C 16: 34,699,894 (GRCm39) S419T probably benign Het
Nfxl1 T C 5: 72,680,879 (GRCm39) K747R probably benign Het
Nup98 T G 7: 101,773,404 (GRCm39) H1641P possibly damaging Het
Or8b35 A C 9: 37,903,856 (GRCm39) T18P probably damaging Het
Pcm1 A G 8: 41,728,736 (GRCm39) N570D probably damaging Het
Plekhh1 T A 12: 79,101,905 (GRCm39) V325E probably benign Het
Rabl3 A T 16: 37,384,120 (GRCm39) I176F probably damaging Het
Relb T C 7: 19,353,767 (GRCm39) E37G possibly damaging Het
Slc4a7 G A 14: 14,773,348 (GRCm38) E773K probably benign Het
Tars2 G A 3: 95,658,294 (GRCm39) T177I probably benign Het
Tmem175 A G 5: 108,792,432 (GRCm39) E236G possibly damaging Het
Trank1 A G 9: 111,220,753 (GRCm39) T2497A probably benign Het
Trf A G 9: 103,105,168 (GRCm39) V48A probably benign Het
Ttc28 A G 5: 111,331,258 (GRCm39) K493E possibly damaging Het
Unc50 T C 1: 37,470,402 (GRCm39) S9P probably benign Het
Uso1 T A 5: 92,341,861 (GRCm39) probably null Het
Usp49 A T 17: 47,985,753 (GRCm39) N487I possibly damaging Het
Xab2 T C 8: 3,660,638 (GRCm39) D768G probably benign Het
Xcr1 T C 9: 123,685,657 (GRCm39) E35G possibly damaging Het
Other mutations in Tenm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Tenm2 APN 11 36,097,726 (GRCm39) splice site probably benign
IGL00834:Tenm2 APN 11 35,915,085 (GRCm39) missense probably damaging 1.00
IGL00911:Tenm2 APN 11 35,899,560 (GRCm39) nonsense probably null
IGL00937:Tenm2 APN 11 35,915,450 (GRCm39) missense probably damaging 1.00
IGL01154:Tenm2 APN 11 35,932,371 (GRCm39) missense probably damaging 1.00
IGL01313:Tenm2 APN 11 35,915,075 (GRCm39) missense probably damaging 0.98
IGL01346:Tenm2 APN 11 35,918,232 (GRCm39) nonsense probably null
IGL01539:Tenm2 APN 11 35,997,654 (GRCm39) missense possibly damaging 0.89
IGL01629:Tenm2 APN 11 36,755,711 (GRCm39) missense probably damaging 0.98
IGL01780:Tenm2 APN 11 35,937,768 (GRCm39) missense probably benign
IGL01821:Tenm2 APN 11 35,914,710 (GRCm39) missense probably damaging 0.98
IGL01988:Tenm2 APN 11 35,918,078 (GRCm39) missense probably damaging 1.00
IGL02002:Tenm2 APN 11 36,097,922 (GRCm39) missense probably benign
IGL02449:Tenm2 APN 11 35,914,449 (GRCm39) missense probably damaging 0.99
IGL02505:Tenm2 APN 11 35,942,743 (GRCm39) nonsense probably null
IGL02649:Tenm2 APN 11 36,097,912 (GRCm39) missense possibly damaging 0.85
IGL02688:Tenm2 APN 11 35,959,285 (GRCm39) missense probably benign 0.05
IGL02801:Tenm2 APN 11 35,937,857 (GRCm39) nonsense probably null
IGL02928:Tenm2 APN 11 35,917,997 (GRCm39) missense possibly damaging 0.69
IGL02940:Tenm2 APN 11 35,932,471 (GRCm39) missense probably damaging 1.00
IGL03202:Tenm2 APN 11 35,915,375 (GRCm39) missense probably damaging 1.00
IGL03213:Tenm2 APN 11 35,914,157 (GRCm39) missense probably benign 0.05
IGL03276:Tenm2 APN 11 35,963,603 (GRCm39) missense possibly damaging 0.95
IGL03296:Tenm2 APN 11 35,942,852 (GRCm39) splice site probably null
IGL03381:Tenm2 APN 11 35,959,238 (GRCm39) missense probably benign 0.01
IGL03398:Tenm2 APN 11 35,915,370 (GRCm39) missense probably damaging 1.00
browser UTSW 11 35,937,592 (GRCm39) critical splice donor site probably null
mosaic UTSW 11 35,954,602 (GRCm39) critical splice donor site probably null
IGL02799:Tenm2 UTSW 11 36,164,235 (GRCm39) missense probably damaging 1.00
PIT4260001:Tenm2 UTSW 11 36,054,557 (GRCm39) missense probably damaging 1.00
PIT4382001:Tenm2 UTSW 11 35,954,729 (GRCm39) missense probably damaging 0.99
R0004:Tenm2 UTSW 11 35,914,184 (GRCm39) missense probably damaging 1.00
R0420:Tenm2 UTSW 11 36,097,951 (GRCm39) splice site probably benign
R0537:Tenm2 UTSW 11 36,054,557 (GRCm39) missense probably damaging 1.00
R0599:Tenm2 UTSW 11 35,915,607 (GRCm39) missense possibly damaging 0.93
R0636:Tenm2 UTSW 11 36,834,803 (GRCm39) missense probably damaging 1.00
R0693:Tenm2 UTSW 11 35,915,636 (GRCm39) missense probably damaging 1.00
R0991:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R0992:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1167:Tenm2 UTSW 11 36,755,511 (GRCm39) missense probably benign 0.30
R1177:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1178:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1179:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1180:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1181:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1193:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1194:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1195:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1195:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1195:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1259:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1265:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1267:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1268:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1269:Tenm2 UTSW 11 35,899,185 (GRCm39) missense possibly damaging 0.64
R1270:Tenm2 UTSW 11 35,932,486 (GRCm39) missense probably damaging 1.00
R1272:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1273:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1311:Tenm2 UTSW 11 35,959,421 (GRCm39) splice site probably benign
R1374:Tenm2 UTSW 11 35,899,281 (GRCm39) missense probably benign 0.00
R1542:Tenm2 UTSW 11 36,191,047 (GRCm39) missense probably damaging 0.99
R1573:Tenm2 UTSW 11 35,937,896 (GRCm39) missense probably damaging 1.00
R1579:Tenm2 UTSW 11 35,997,610 (GRCm39) missense probably damaging 1.00
R1697:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1722:Tenm2 UTSW 11 35,898,930 (GRCm39) missense probably damaging 1.00
R1756:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1793:Tenm2 UTSW 11 35,914,209 (GRCm39) missense probably damaging 0.99
R1950:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1954:Tenm2 UTSW 11 35,938,374 (GRCm39) missense possibly damaging 0.87
R2025:Tenm2 UTSW 11 35,938,091 (GRCm39) nonsense probably null
R2117:Tenm2 UTSW 11 35,915,681 (GRCm39) missense probably damaging 1.00
R2244:Tenm2 UTSW 11 36,755,689 (GRCm39) missense probably damaging 0.98
R2298:Tenm2 UTSW 11 35,937,604 (GRCm39) missense possibly damaging 0.62
R2432:Tenm2 UTSW 11 35,918,018 (GRCm39) missense probably damaging 1.00
R3014:Tenm2 UTSW 11 35,914,800 (GRCm39) missense probably damaging 1.00
R3115:Tenm2 UTSW 11 35,914,193 (GRCm39) missense probably damaging 1.00
R3684:Tenm2 UTSW 11 35,942,644 (GRCm39) missense probably benign 0.00
R3685:Tenm2 UTSW 11 35,942,644 (GRCm39) missense probably benign 0.00
R3705:Tenm2 UTSW 11 35,959,153 (GRCm39) missense probably damaging 0.97
R3820:Tenm2 UTSW 11 35,915,147 (GRCm39) missense probably damaging 0.98
R3821:Tenm2 UTSW 11 35,915,147 (GRCm39) missense probably damaging 0.98
R3822:Tenm2 UTSW 11 35,915,147 (GRCm39) missense probably damaging 0.98
R3844:Tenm2 UTSW 11 35,938,365 (GRCm39) missense probably damaging 0.98
R3878:Tenm2 UTSW 11 36,030,401 (GRCm39) critical splice donor site probably null
R4019:Tenm2 UTSW 11 35,937,901 (GRCm39) missense probably benign 0.04
R4062:Tenm2 UTSW 11 35,899,482 (GRCm39) missense probably damaging 1.00
R4367:Tenm2 UTSW 11 35,918,225 (GRCm39) missense probably benign
R4395:Tenm2 UTSW 11 35,915,451 (GRCm39) missense probably benign 0.23
R4508:Tenm2 UTSW 11 35,899,172 (GRCm39) missense possibly damaging 0.82
R4534:Tenm2 UTSW 11 35,953,931 (GRCm39) missense possibly damaging 0.64
R4539:Tenm2 UTSW 11 35,937,607 (GRCm39) missense probably damaging 1.00
R4644:Tenm2 UTSW 11 35,937,963 (GRCm39) missense probably benign 0.00
R4661:Tenm2 UTSW 11 35,915,275 (GRCm39) missense probably damaging 0.99
R4669:Tenm2 UTSW 11 35,901,314 (GRCm39) missense probably damaging 1.00
R4687:Tenm2 UTSW 11 35,939,924 (GRCm39) missense probably benign
R4711:Tenm2 UTSW 11 36,191,039 (GRCm39) missense probably damaging 0.98
R4816:Tenm2 UTSW 11 35,918,117 (GRCm39) missense probably damaging 1.00
R4843:Tenm2 UTSW 11 35,914,847 (GRCm39) missense probably damaging 1.00
R4850:Tenm2 UTSW 11 35,914,315 (GRCm39) nonsense probably null
R4870:Tenm2 UTSW 11 35,969,396 (GRCm39) missense probably damaging 1.00
R5058:Tenm2 UTSW 11 36,097,907 (GRCm39) missense possibly damaging 0.80
R5071:Tenm2 UTSW 11 35,959,208 (GRCm39) missense probably damaging 0.99
R5073:Tenm2 UTSW 11 35,959,208 (GRCm39) missense probably damaging 0.99
R5074:Tenm2 UTSW 11 35,959,208 (GRCm39) missense probably damaging 0.99
R5081:Tenm2 UTSW 11 35,915,460 (GRCm39) missense possibly damaging 0.95
R5093:Tenm2 UTSW 11 36,834,989 (GRCm39) missense probably damaging 1.00
R5170:Tenm2 UTSW 11 35,915,633 (GRCm39) missense probably damaging 0.98
R5253:Tenm2 UTSW 11 35,938,028 (GRCm39) nonsense probably null
R5343:Tenm2 UTSW 11 35,960,330 (GRCm39) missense probably benign 0.00
R5493:Tenm2 UTSW 11 36,755,503 (GRCm39) missense probably benign 0.01
R5600:Tenm2 UTSW 11 36,054,541 (GRCm39) splice site probably null
R5677:Tenm2 UTSW 11 36,032,510 (GRCm39) missense probably damaging 0.98
R5703:Tenm2 UTSW 11 35,914,626 (GRCm39) missense probably benign 0.34
R5707:Tenm2 UTSW 11 35,938,009 (GRCm39) missense possibly damaging 0.79
R6026:Tenm2 UTSW 11 35,963,556 (GRCm39) critical splice donor site probably null
R6063:Tenm2 UTSW 11 36,054,544 (GRCm39) critical splice donor site probably null
R6086:Tenm2 UTSW 11 35,899,473 (GRCm39) missense possibly damaging 0.64
R6151:Tenm2 UTSW 11 35,899,610 (GRCm39) missense probably damaging 1.00
R6169:Tenm2 UTSW 11 36,030,517 (GRCm39) missense probably damaging 0.99
R6193:Tenm2 UTSW 11 35,937,621 (GRCm39) missense probably damaging 1.00
R6405:Tenm2 UTSW 11 36,755,686 (GRCm39) missense probably benign 0.44
R6477:Tenm2 UTSW 11 35,901,334 (GRCm39) critical splice acceptor site probably null
R6607:Tenm2 UTSW 11 35,954,602 (GRCm39) critical splice donor site probably null
R6668:Tenm2 UTSW 11 35,937,592 (GRCm39) critical splice donor site probably null
R6825:Tenm2 UTSW 11 35,937,711 (GRCm39) missense probably benign 0.02
R6885:Tenm2 UTSW 11 35,914,407 (GRCm39) missense possibly damaging 0.95
R7017:Tenm2 UTSW 11 36,062,236 (GRCm39) missense probably damaging 0.98
R7115:Tenm2 UTSW 11 36,054,644 (GRCm39) missense probably damaging 0.99
R7153:Tenm2 UTSW 11 35,915,009 (GRCm39) missense probably damaging 0.98
R7173:Tenm2 UTSW 11 35,932,378 (GRCm39) missense probably damaging 0.99
R7199:Tenm2 UTSW 11 36,062,263 (GRCm39) missense probably damaging 1.00
R7205:Tenm2 UTSW 11 35,939,956 (GRCm39) missense probably damaging 0.99
R7250:Tenm2 UTSW 11 35,963,625 (GRCm39) missense probably damaging 1.00
R7290:Tenm2 UTSW 11 35,914,298 (GRCm39) missense probably damaging 1.00
R7366:Tenm2 UTSW 11 35,960,241 (GRCm39) missense probably benign 0.09
R7432:Tenm2 UTSW 11 36,755,768 (GRCm39) missense probably benign
R7504:Tenm2 UTSW 11 36,030,570 (GRCm39) missense probably damaging 1.00
R7513:Tenm2 UTSW 11 35,942,727 (GRCm39) missense probably benign 0.34
R7523:Tenm2 UTSW 11 35,969,408 (GRCm39) splice site probably null
R7527:Tenm2 UTSW 11 36,097,803 (GRCm39) missense probably damaging 1.00
R7653:Tenm2 UTSW 11 35,938,174 (GRCm39) missense probably benign 0.09
R7717:Tenm2 UTSW 11 36,755,762 (GRCm39) missense probably damaging 0.97
R7739:Tenm2 UTSW 11 35,960,388 (GRCm39) missense possibly damaging 0.50
R7762:Tenm2 UTSW 11 35,914,133 (GRCm39) missense possibly damaging 0.74
R7786:Tenm2 UTSW 11 35,901,276 (GRCm39) missense probably damaging 0.99
R7803:Tenm2 UTSW 11 35,937,943 (GRCm39) missense probably damaging 0.98
R7834:Tenm2 UTSW 11 35,915,681 (GRCm39) missense probably damaging 1.00
R7838:Tenm2 UTSW 11 35,997,626 (GRCm39) missense probably benign 0.02
R8073:Tenm2 UTSW 11 36,030,471 (GRCm39) missense possibly damaging 0.56
R8076:Tenm2 UTSW 11 35,918,048 (GRCm39) missense probably benign 0.23
R8109:Tenm2 UTSW 11 35,899,137 (GRCm39) missense probably benign
R8306:Tenm2 UTSW 11 35,960,196 (GRCm39) missense possibly damaging 0.52
R8352:Tenm2 UTSW 11 35,914,428 (GRCm39) missense probably damaging 0.98
R8452:Tenm2 UTSW 11 35,914,428 (GRCm39) missense probably damaging 0.98
R8864:Tenm2 UTSW 11 35,918,022 (GRCm39) missense possibly damaging 0.95
R8880:Tenm2 UTSW 11 35,942,788 (GRCm39) missense probably damaging 0.99
R8943:Tenm2 UTSW 11 36,834,861 (GRCm39) missense probably damaging 0.98
R8969:Tenm2 UTSW 11 35,942,688 (GRCm39) missense probably damaging 0.99
R9168:Tenm2 UTSW 11 35,930,722 (GRCm39) missense probably damaging 1.00
R9279:Tenm2 UTSW 11 35,959,303 (GRCm39) missense probably benign 0.00
R9294:Tenm2 UTSW 11 35,915,327 (GRCm39) missense probably damaging 0.98
R9320:Tenm2 UTSW 11 35,914,474 (GRCm39) missense probably damaging 0.99
R9373:Tenm2 UTSW 11 35,930,713 (GRCm39) missense probably damaging 1.00
R9408:Tenm2 UTSW 11 35,960,246 (GRCm39) missense probably damaging 1.00
R9410:Tenm2 UTSW 11 36,032,396 (GRCm39) missense probably damaging 0.99
R9454:Tenm2 UTSW 11 36,112,286 (GRCm39) missense probably benign
R9489:Tenm2 UTSW 11 36,834,791 (GRCm39) missense probably damaging 0.99
R9711:Tenm2 UTSW 11 35,915,341 (GRCm39) missense probably damaging 0.99
RF021:Tenm2 UTSW 11 35,915,030 (GRCm39) missense possibly damaging 0.95
X0018:Tenm2 UTSW 11 35,915,027 (GRCm39) missense probably damaging 1.00
X0063:Tenm2 UTSW 11 35,915,557 (GRCm39) missense probably benign
Z1088:Tenm2 UTSW 11 36,164,094 (GRCm39) missense probably damaging 1.00
Z1177:Tenm2 UTSW 11 36,191,162 (GRCm39) missense probably damaging 0.98
Z1177:Tenm2 UTSW 11 35,899,061 (GRCm39) missense possibly damaging 0.95
Z1177:Tenm2 UTSW 11 36,275,957 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCTAAGGATGTGTGTTCTTGACC -3'
(R):5'- TTTGGACAGCAGGTATGGGC -3'

Sequencing Primer
(F):5'- CTTGACCGTATTCACTTCAAAGG -3'
(R):5'- TATGGGCCCCACTGTGAG -3'
Posted On 2019-10-24