Incidental Mutation 'R7648:Atad2b'
ID 590652
Institutional Source Beutler Lab
Gene Symbol Atad2b
Ensembl Gene ENSMUSG00000052812
Gene Name ATPase family, AAA domain containing 2B
Synonyms D530031C13Rik, 1110014E10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7648 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 4917353-5047394 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 5027182 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000047445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045664]
AlphaFold E9Q166
Predicted Effect probably null
Transcript: ENSMUST00000045664
SMART Domains Protein: ENSMUSP00000047445
Gene: ENSMUSG00000052812

DomainStartEndE-ValueType
low complexity region 13 54 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
low complexity region 252 278 N/A INTRINSIC
AAA 432 573 4.56e-20 SMART
SCOP:d1e32a2 771 912 3e-4 SMART
BROMO 958 1070 4.24e-20 SMART
low complexity region 1135 1144 N/A INTRINSIC
low complexity region 1230 1253 N/A INTRINSIC
Meta Mutation Damage Score 0.9497 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the AAA ATPase family. This family member includes an N-terminal bromodomain. It has been found to be localized to the nucleus, partly to replication sites, consistent with a chromatin-related function. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit reduced body size and fertility in female mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T C 7: 41,612,462 V46A possibly damaging Het
Asb13 C A 13: 3,649,332 N177K probably damaging Het
Asprv1 A G 6: 86,628,870 T233A probably damaging Het
Atxn2 G T 5: 121,796,377 V880F probably damaging Het
Car14 T C 3: 95,898,195 N322S probably benign Het
Cdc42bpb T C 12: 111,377,153 E40G probably damaging Het
Ceacam16 G T 7: 19,852,278 A103E unknown Het
Cnnm2 A G 19: 46,877,900 D829G probably damaging Het
Cpt1b C T 15: 89,421,367 A382T probably damaging Het
Crygc A G 1: 65,073,325 F30S probably damaging Het
Cstf2t A G 19: 31,083,592 Q176R possibly damaging Het
Ctif A T 18: 75,637,142 H57Q probably benign Het
Cyp2c40 A G 19: 39,803,845 *195Q probably null Het
Cyp2j8 T A 4: 96,499,603 D207V probably damaging Het
Ddx49 A G 8: 70,297,955 V123A possibly damaging Het
E4f1 A T 17: 24,445,448 I456K probably benign Het
Eif4b T C 15: 102,089,000 S317P unknown Het
Enam A T 5: 88,504,157 Q1175L possibly damaging Het
Eppk1 T C 15: 76,110,671 Y670C probably benign Het
Fam163b G T 2: 27,112,740 Q82K probably benign Het
Fam193a A T 5: 34,431,182 K358N probably damaging Het
Gls C A 1: 52,196,780 R392L probably damaging Het
Gm12569 G A 11: 51,234,786 E179K possibly damaging Het
Gramd1c A G 16: 43,989,869 V247A probably damaging Het
Gucy1a1 C T 3: 82,108,707 E325K possibly damaging Het
Hectd4 T C 5: 121,254,371 C233R possibly damaging Het
Ice1 A G 13: 70,589,797 V2177A possibly damaging Het
Kif28 A G 1: 179,709,424 V498A possibly damaging Het
Klhdc7a T C 4: 139,965,939 S566G possibly damaging Het
Mlph G A 1: 90,933,526 probably null Het
Mndal T A 1: 173,857,395 Y536F probably benign Het
Mrgpra2a A T 7: 47,426,663 C282* probably null Het
Msh3 A T 13: 92,274,028 I684N probably damaging Het
Mylk G C 16: 34,879,524 S419T probably benign Het
Nfxl1 T C 5: 72,523,536 K747R probably benign Het
Nup98 T G 7: 102,124,197 H1641P possibly damaging Het
Olfr881 A C 9: 37,992,560 T18P probably damaging Het
Pcm1 A G 8: 41,275,699 N570D probably damaging Het
Plekhh1 T A 12: 79,055,131 V325E probably benign Het
Rabl3 A T 16: 37,563,758 I176F probably damaging Het
Relb T C 7: 19,619,842 E37G possibly damaging Het
Slc4a7 G A 14: 14,773,348 E773K probably benign Het
Tars2 G A 3: 95,750,982 T177I probably benign Het
Tenm2 T A 11: 36,106,736 N842I probably damaging Het
Tmem175 A G 5: 108,644,566 E236G possibly damaging Het
Trank1 A G 9: 111,391,685 T2497A probably benign Het
Trf A G 9: 103,227,969 V48A probably benign Het
Ttc28 A G 5: 111,183,392 K493E possibly damaging Het
Unc50 T C 1: 37,431,321 S9P probably benign Het
Uso1 T A 5: 92,194,002 probably null Het
Usp49 A T 17: 47,674,828 N487I possibly damaging Het
Xab2 T C 8: 3,610,638 D768G probably benign Het
Xcr1 T C 9: 123,856,592 E35G possibly damaging Het
Other mutations in Atad2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Atad2b APN 12 5024593 missense probably damaging 1.00
IGL00917:Atad2b APN 12 4965837 unclassified probably benign
IGL01011:Atad2b APN 12 4965984 missense probably benign 0.01
IGL01092:Atad2b APN 12 5017987 missense probably damaging 0.98
IGL01604:Atad2b APN 12 4965837 unclassified probably benign
IGL01924:Atad2b APN 12 5034093 missense probably damaging 1.00
IGL02197:Atad2b APN 12 5018056 missense possibly damaging 0.84
IGL02397:Atad2b APN 12 4974046 missense probably damaging 1.00
IGL02404:Atad2b APN 12 4941972 missense probably benign 0.08
IGL02517:Atad2b APN 12 5018037 missense probably benign 0.07
IGL02726:Atad2b APN 12 4974003 nonsense probably null
IGL02896:Atad2b APN 12 4958151 missense probably damaging 1.00
IGL03227:Atad2b APN 12 5006715 missense probably damaging 1.00
IGL03265:Atad2b APN 12 5024628 missense probably benign 0.24
Plyers UTSW 12 4973970 missense probably damaging 1.00
Smidge UTSW 12 4990949 missense probably damaging 1.00
Tensor UTSW 12 4957558 missense probably damaging 1.00
Traction UTSW 12 5027182 critical splice donor site probably null
Vice UTSW 12 5018002 missense probably damaging 1.00
K3955:Atad2b UTSW 12 4954536 splice site probably benign
P0038:Atad2b UTSW 12 4954536 splice site probably benign
PIT4418001:Atad2b UTSW 12 5024587 missense probably benign 0.07
PIT4431001:Atad2b UTSW 12 5031795 missense possibly damaging 0.77
R0006:Atad2b UTSW 12 4942030 missense possibly damaging 0.81
R0006:Atad2b UTSW 12 4942030 missense possibly damaging 0.81
R0124:Atad2b UTSW 12 4952676 missense probably benign 0.23
R0462:Atad2b UTSW 12 4941973 missense possibly damaging 0.79
R0483:Atad2b UTSW 12 4945035 splice site probably benign
R0617:Atad2b UTSW 12 4937401 missense probably benign 0.43
R0894:Atad2b UTSW 12 4965915 missense probably damaging 1.00
R0942:Atad2b UTSW 12 5024591 missense probably damaging 1.00
R0960:Atad2b UTSW 12 5006593 splice site probably benign
R0973:Atad2b UTSW 12 5031784 missense probably benign 0.00
R1306:Atad2b UTSW 12 4974239 missense probably benign 0.08
R1530:Atad2b UTSW 12 4942018 nonsense probably null
R1678:Atad2b UTSW 12 4965899 missense possibly damaging 0.91
R1689:Atad2b UTSW 12 5034575 nonsense probably null
R1826:Atad2b UTSW 12 4974094 missense probably benign 0.00
R1996:Atad2b UTSW 12 4990883 missense probably benign 0.01
R2233:Atad2b UTSW 12 5006745 missense probably damaging 1.00
R2235:Atad2b UTSW 12 5006745 missense probably damaging 1.00
R2943:Atad2b UTSW 12 4942067 missense probably damaging 0.98
R3161:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3162:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3162:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3508:Atad2b UTSW 12 4950595 critical splice donor site probably null
R4239:Atad2b UTSW 12 4985710 missense probably benign 0.05
R4401:Atad2b UTSW 12 4940145 missense probably damaging 0.99
R4558:Atad2b UTSW 12 4943223 missense probably benign 0.10
R4559:Atad2b UTSW 12 4943223 missense probably benign 0.10
R4573:Atad2b UTSW 12 4954663 splice site probably null
R4639:Atad2b UTSW 12 5018053 missense probably damaging 1.00
R4847:Atad2b UTSW 12 4944901 splice site probably null
R4850:Atad2b UTSW 12 4943251 missense probably benign 0.15
R4851:Atad2b UTSW 12 4943251 missense probably benign 0.15
R4979:Atad2b UTSW 12 5034513 missense probably damaging 1.00
R5024:Atad2b UTSW 12 4937534 missense probably benign 0.45
R5305:Atad2b UTSW 12 4965855 missense probably damaging 1.00
R5405:Atad2b UTSW 12 4940098 missense possibly damaging 0.87
R5627:Atad2b UTSW 12 4917911 missense probably benign 0.01
R5754:Atad2b UTSW 12 5010351 missense probably benign 0.01
R6163:Atad2b UTSW 12 4954593 missense probably benign 0.00
R6371:Atad2b UTSW 12 4973970 missense probably damaging 1.00
R6374:Atad2b UTSW 12 5018002 missense probably damaging 1.00
R6399:Atad2b UTSW 12 4957558 missense probably damaging 1.00
R6433:Atad2b UTSW 12 4952642 missense possibly damaging 0.89
R6546:Atad2b UTSW 12 4990949 missense probably damaging 1.00
R6617:Atad2b UTSW 12 5024668 missense probably benign 0.00
R7199:Atad2b UTSW 12 5017992 missense probably damaging 1.00
R7267:Atad2b UTSW 12 5027105 nonsense probably null
R7405:Atad2b UTSW 12 4943232 missense probably benign 0.08
R7460:Atad2b UTSW 12 4952660 missense probably benign 0.28
R7568:Atad2b UTSW 12 5010390 critical splice donor site probably null
R7593:Atad2b UTSW 12 5031726 missense probably benign 0.16
R8253:Atad2b UTSW 12 4974159 missense possibly damaging 0.54
R8253:Atad2b UTSW 12 4974160 missense probably benign 0.02
R8708:Atad2b UTSW 12 4961253 missense probably damaging 1.00
R8894:Atad2b UTSW 12 5014001 critical splice donor site probably null
R8948:Atad2b UTSW 12 4991012 missense possibly damaging 0.87
R8976:Atad2b UTSW 12 4917923 critical splice donor site probably null
R9052:Atad2b UTSW 12 4965982 missense probably damaging 1.00
R9057:Atad2b UTSW 12 5018102 nonsense probably null
R9134:Atad2b UTSW 12 5010351 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATGCAGCTGGGAACATGTAAC -3'
(R):5'- AACACCAAACATGTTTCAAGGG -3'

Sequencing Primer
(F):5'- GCTGGGAACATGTAACTAAGTAGTTC -3'
(R):5'- AAGCTCCTCTCTGGAAAG -3'
Posted On 2019-10-24