Incidental Mutation 'R7648:Ctif'
ID590667
Institutional Source Beutler Lab
Gene Symbol Ctif
Ensembl Gene ENSMUSG00000052928
Gene NameCBP80/20-dependent translation initiation factor
SynonymsLOC269037, Gm672
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R7648 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location75431224-75697696 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 75637142 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 57 (H57Q)
Ref Sequence ENSEMBL: ENSMUSP00000129974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165559]
Predicted Effect probably benign
Transcript: ENSMUST00000165559
AA Change: H57Q

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000129974
Gene: ENSMUSG00000052928
AA Change: H57Q

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 188 204 N/A INTRINSIC
low complexity region 347 360 N/A INTRINSIC
MIF4G 401 602 5.46e-35 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CTIF is a component of the CBP80 (NCBP1; MIM 600469)/CBP20 (NCBP2; MIM 605133) translation initiation complex that binds cotranscriptionally to the cap end of nascent mRNA. The CBP80/CBP20 complex is involved in a simultaneous editing and translation step that recognizes premature termination codons (PTCs) in mRNAs and directs PTC-containing mRNAs toward nonsense-mediated decay (NMD). On mRNAs without PTCs, the CBP80/CBP20 complex is replaced with cytoplasmic mRNA cap-binding proteins, including EIF4G (MIM 600495), and steady-state translation of the mRNAs resumes in the cytoplasm (Kim et al., 2009 [PubMed 19648179]).[supplied by OMIM, Dec 2009]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T C 7: 41,612,462 V46A possibly damaging Het
Asb13 C A 13: 3,649,332 N177K probably damaging Het
Asprv1 A G 6: 86,628,870 T233A probably damaging Het
Atad2b T A 12: 5,027,182 probably null Het
Atxn2 G T 5: 121,796,377 V880F probably damaging Het
Car14 T C 3: 95,898,195 N322S probably benign Het
Cdc42bpb T C 12: 111,377,153 E40G probably damaging Het
Ceacam16 G T 7: 19,852,278 A103E unknown Het
Cnnm2 A G 19: 46,877,900 D829G probably damaging Het
Cpt1b C T 15: 89,421,367 A382T probably damaging Het
Crygc A G 1: 65,073,325 F30S probably damaging Het
Cstf2t A G 19: 31,083,592 Q176R possibly damaging Het
Cyp2c40 A G 19: 39,803,845 *195Q probably null Het
Cyp2j8 T A 4: 96,499,603 D207V probably damaging Het
Ddx49 A G 8: 70,297,955 V123A possibly damaging Het
E4f1 A T 17: 24,445,448 I456K probably benign Het
Eif4b T C 15: 102,089,000 S317P unknown Het
Enam A T 5: 88,504,157 Q1175L possibly damaging Het
Eppk1 T C 15: 76,110,671 Y670C probably benign Het
Fam163b G T 2: 27,112,740 Q82K probably benign Het
Fam193a A T 5: 34,431,182 K358N probably damaging Het
Gls C A 1: 52,196,780 R392L probably damaging Het
Gm12569 G A 11: 51,234,786 E179K possibly damaging Het
Gramd1c A G 16: 43,989,869 V247A probably damaging Het
Gucy1a1 C T 3: 82,108,707 E325K possibly damaging Het
Hectd4 T C 5: 121,254,371 C233R possibly damaging Het
Ice1 A G 13: 70,589,797 V2177A possibly damaging Het
Kif28 A G 1: 179,709,424 V498A possibly damaging Het
Klhdc7a T C 4: 139,965,939 S566G possibly damaging Het
Mlph G A 1: 90,933,526 probably null Het
Mndal T A 1: 173,857,395 Y536F probably benign Het
Mrgpra2a A T 7: 47,426,663 C282* probably null Het
Msh3 A T 13: 92,274,028 I684N probably damaging Het
Mylk G C 16: 34,879,524 S419T probably benign Het
Nfxl1 T C 5: 72,523,536 K747R probably benign Het
Nup98 T G 7: 102,124,197 H1641P possibly damaging Het
Olfr881 A C 9: 37,992,560 T18P probably damaging Het
Pcm1 A G 8: 41,275,699 N570D probably damaging Het
Plekhh1 T A 12: 79,055,131 V325E probably benign Het
Rabl3 A T 16: 37,563,758 I176F probably damaging Het
Relb T C 7: 19,619,842 E37G possibly damaging Het
Slc4a7 G A 14: 14,773,348 E773K probably benign Het
Tars2 G A 3: 95,750,982 T177I probably benign Het
Tenm2 T A 11: 36,106,736 N842I probably damaging Het
Tmem175 A G 5: 108,644,566 E236G possibly damaging Het
Trank1 A G 9: 111,391,685 T2497A probably benign Het
Trf A G 9: 103,227,969 V48A probably benign Het
Ttc28 A G 5: 111,183,392 K493E possibly damaging Het
Unc50 T C 1: 37,431,321 S9P probably benign Het
Uso1 T A 5: 92,194,002 probably null Het
Usp49 A T 17: 47,674,828 N487I possibly damaging Het
Xab2 T C 8: 3,610,638 D768G probably benign Het
Xcr1 T C 9: 123,856,592 E35G possibly damaging Het
Other mutations in Ctif
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Ctif APN 18 75437176 missense possibly damaging 0.95
IGL01481:Ctif APN 18 75611784 splice site probably benign
IGL02299:Ctif APN 18 75637245 missense probably damaging 1.00
IGL02319:Ctif APN 18 75521873 splice site probably benign
IGL03130:Ctif APN 18 75521618 missense probably benign
R0304:Ctif UTSW 18 75521818 missense probably benign 0.09
R0730:Ctif UTSW 18 75565012 missense probably damaging 0.99
R0835:Ctif UTSW 18 75435336 missense probably damaging 1.00
R1226:Ctif UTSW 18 75521579 small deletion probably benign
R1302:Ctif UTSW 18 75521678 missense probably benign 0.22
R1549:Ctif UTSW 18 75565025 missense probably damaging 1.00
R1674:Ctif UTSW 18 75637180 missense probably benign 0.00
R1697:Ctif UTSW 18 75624305 splice site probably benign
R1848:Ctif UTSW 18 75519941 missense probably damaging 0.96
R2102:Ctif UTSW 18 75521381 missense probably benign
R3499:Ctif UTSW 18 75611757 missense possibly damaging 0.94
R3878:Ctif UTSW 18 75519977 missense probably damaging 0.96
R4157:Ctif UTSW 18 75435270 missense probably benign 0.42
R4168:Ctif UTSW 18 75637215 missense probably damaging 1.00
R4225:Ctif UTSW 18 75435237 missense probably benign 0.01
R4560:Ctif UTSW 18 75519881 missense probably damaging 1.00
R4822:Ctif UTSW 18 75521561 missense probably benign 0.01
R5176:Ctif UTSW 18 75637219 missense probably damaging 1.00
R5824:Ctif UTSW 18 75610678 missense possibly damaging 0.55
R6824:Ctif UTSW 18 75521711 missense probably damaging 1.00
R6934:Ctif UTSW 18 75435360 missense probably benign 0.07
R7014:Ctif UTSW 18 75437208 missense possibly damaging 0.82
R7115:Ctif UTSW 18 75471803 critical splice donor site probably benign
R7169:Ctif UTSW 18 75472016 missense probably damaging 0.99
R7187:Ctif UTSW 18 75637219 missense probably damaging 1.00
R7355:Ctif UTSW 18 75610685 missense probably damaging 0.98
R7402:Ctif UTSW 18 75611736 missense probably benign 0.18
R7451:Ctif UTSW 18 75519803 missense possibly damaging 0.82
R7671:Ctif UTSW 18 75472016 missense probably damaging 0.99
R7746:Ctif UTSW 18 75471803 critical splice donor site probably benign
R7765:Ctif UTSW 18 75605644 missense probably damaging 1.00
R7805:Ctif UTSW 18 75471803 critical splice donor site probably benign
X0027:Ctif UTSW 18 75637263 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGAGATGGGTTCAAAGGTC -3'
(R):5'- GAGAACTCCTCAGCAGCTTC -3'

Sequencing Primer
(F):5'- AGGCTTCCTGGATGGATCTCTAAAC -3'
(R):5'- GCAGCTTCAGCCTCCTCTGAG -3'
Posted On2019-10-24