Incidental Mutation 'R7649:Prr14l'
ID 590686
Institutional Source Beutler Lab
Gene Symbol Prr14l
Ensembl Gene ENSMUSG00000054280
Gene Name proline rich 14-like
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock # R7649 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 32789820-32854256 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 32828245 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 1302 (G1302D)
Ref Sequence ENSEMBL: ENSMUSP00000113259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120129] [ENSMUST00000144673] [ENSMUST00000155392]
AlphaFold E9Q7C4
Predicted Effect probably benign
Transcript: ENSMUST00000120129
AA Change: G1302D

PolyPhen 2 Score 0.181 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000113259
Gene: ENSMUSG00000054280
AA Change: G1302D

DomainStartEndE-ValueType
low complexity region 720 731 N/A INTRINSIC
low complexity region 1433 1446 N/A INTRINSIC
low complexity region 1471 1480 N/A INTRINSIC
Pfam:Tantalus 1838 1895 2.9e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144673
SMART Domains Protein: ENSMUSP00000124923
Gene: ENSMUSG00000093574

DomainStartEndE-ValueType
Pfam:Tantalus 158 193 1.2e-15 PFAM
Pfam:PS_Dcarbxylase 332 575 2.1e-71 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000155392
AA Change: G145D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000119569
Gene: ENSMUSG00000054280
AA Change: G145D

DomainStartEndE-ValueType
low complexity region 276 289 N/A INTRINSIC
low complexity region 314 323 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr3b T C 5: 25,848,366 V319A probably benign Het
Adam28 T A 14: 68,634,833 Y320F probably benign Het
Adam4 T C 12: 81,420,377 Y490C probably damaging Het
Ampd3 G T 7: 110,777,842 L13F probably benign Het
Arhgap45 C A 10: 80,031,001 Q1113K probably benign Het
Arid5b T C 10: 68,118,345 T370A possibly damaging Het
Arl15 A G 13: 113,967,672 D115G possibly damaging Het
AW146154 G A 7: 41,480,732 T320I probably benign Het
Cdh17 C T 4: 11,814,698 P751L probably damaging Het
Chchd4 C T 6: 91,467,772 R11Q probably benign Het
Clta T G 4: 44,025,494 I140R possibly damaging Het
Cnpy1 T C 5: 28,207,284 T84A probably benign Het
Cpne5 T C 17: 29,226,198 D44G probably damaging Het
Crkl T C 16: 17,452,502 S9P unknown Het
Csmd3 T C 15: 47,669,143 D1641G Het
Ctnnd2 A G 15: 31,027,484 T1185A probably benign Het
Dlc1 A T 8: 36,582,740 L607Q probably damaging Het
Dpy19l2 T C 9: 24,696,163 M1V probably null Het
Dst T C 1: 34,167,697 V982A probably benign Het
Fam135b T C 15: 71,462,580 I922V probably benign Het
Fbxl13 T C 5: 21,614,666 E245G probably benign Het
Fcgbp T C 7: 28,091,503 S730P possibly damaging Het
Ggt1 T C 10: 75,585,456 V468A possibly damaging Het
Gja5 A T 3: 97,051,641 H338L probably benign Het
Herpud2 T C 9: 25,110,606 E248G possibly damaging Het
Il17rd C A 14: 27,039,210 A36E probably benign Het
Irf2bpl T C 12: 86,882,798 Y367C possibly damaging Het
Lama1 T A 17: 67,737,554 D149E Het
Lipf A T 19: 33,965,698 E135D possibly damaging Het
Manea T A 4: 26,328,234 D269V probably damaging Het
Megf6 A G 4: 154,265,085 Y910C probably damaging Het
Mical3 G A 6: 120,934,948 R1928W probably damaging Het
Olfr1462 T A 19: 13,190,772 I35N possibly damaging Het
Olfr273 G A 4: 52,855,692 Q274* probably null Het
Plch1 G T 3: 63,698,169 S1438* probably null Het
Por T C 5: 135,734,505 F595L probably damaging Het
Prkcg G A 7: 3,329,964 R634H probably benign Het
Rcan3 A T 4: 135,412,488 S135T probably benign Het
Rnf223 A G 4: 156,132,203 M12V probably benign Het
Rps6kb2 A G 19: 4,157,021 S483P unknown Het
Sacs T A 14: 61,203,228 F908I possibly damaging Het
Slc4a9 A G 18: 36,528,377 Q64R probably benign Het
Slco4c1 T A 1: 96,828,942 I552F probably benign Het
Sppl2b C T 10: 80,867,419 P505L probably benign Het
Sptbn4 A G 7: 27,361,577 S2434P possibly damaging Het
Ssh1 A T 5: 113,950,551 M395K probably benign Het
Stk10 A T 11: 32,577,764 I171F Het
Tmx3 C T 18: 90,540,030 A402V probably damaging Het
Tnfrsf13c T C 15: 82,224,140 D58G possibly damaging Het
Tnk1 T C 11: 69,853,577 probably null Het
Trav14n-3 A T 14: 53,370,494 N94Y probably damaging Het
Trav5-4 A T 14: 53,704,445 K92* probably null Het
Tsga10 C T 1: 37,835,148 R190H unknown Het
Zfhx3 T C 8: 108,951,644 F3109L probably benign Het
Zfhx4 A G 3: 5,242,110 Y132C probably damaging Het
Zfp521 T C 18: 13,844,356 E1000G probably damaging Het
Other mutations in Prr14l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Prr14l APN 5 32830676 missense probably benign 0.04
IGL00331:Prr14l APN 5 32831066 missense probably benign 0.02
IGL01571:Prr14l APN 5 32828806 missense probably benign 0.01
IGL01795:Prr14l APN 5 32831845 unclassified probably benign
IGL01929:Prr14l APN 5 32828243 missense probably benign 0.09
IGL01959:Prr14l APN 5 32830205 missense possibly damaging 0.84
IGL02139:Prr14l APN 5 32827532 missense probably damaging 1.00
IGL02321:Prr14l APN 5 32827807 missense probably benign 0.10
IGL02508:Prr14l APN 5 32830942 missense probably benign 0.01
IGL02551:Prr14l APN 5 32831484 missense probably damaging 1.00
IGL02585:Prr14l APN 5 32829484 missense possibly damaging 0.59
IGL02614:Prr14l APN 5 32830543 missense possibly damaging 0.76
IGL02808:Prr14l APN 5 32828182 missense possibly damaging 0.94
IGL02836:Prr14l APN 5 32831096 missense probably benign 0.42
IGL02952:Prr14l APN 5 32835670 missense unknown
IGL03034:Prr14l APN 5 32827438 missense possibly damaging 0.48
Polymer UTSW 5 32827145 missense probably benign 0.34
Postwar UTSW 5 32830684 missense probably benign 0.17
H8562:Prr14l UTSW 5 32793728 missense probably damaging 1.00
R0086:Prr14l UTSW 5 32831559 unclassified probably benign
R0149:Prr14l UTSW 5 32793641 missense probably damaging 1.00
R0333:Prr14l UTSW 5 32827993 missense probably damaging 1.00
R0361:Prr14l UTSW 5 32793641 missense probably damaging 1.00
R0416:Prr14l UTSW 5 32828717 missense probably benign 0.25
R0480:Prr14l UTSW 5 32829880 missense probably benign 0.02
R0511:Prr14l UTSW 5 32844216 intron probably benign
R0639:Prr14l UTSW 5 32828915 missense probably benign 0.02
R0673:Prr14l UTSW 5 32828915 missense probably benign 0.02
R0743:Prr14l UTSW 5 32831194 missense possibly damaging 0.55
R0792:Prr14l UTSW 5 32828423 missense probably damaging 1.00
R1006:Prr14l UTSW 5 32829482 missense probably benign 0.00
R1342:Prr14l UTSW 5 32830260 missense probably damaging 1.00
R1433:Prr14l UTSW 5 32828833 missense probably damaging 1.00
R1527:Prr14l UTSW 5 32827949 missense possibly damaging 0.75
R1704:Prr14l UTSW 5 32830282 missense probably benign 0.01
R1967:Prr14l UTSW 5 32844469 intron probably benign
R2129:Prr14l UTSW 5 32831828 unclassified probably benign
R2150:Prr14l UTSW 5 32830702 missense probably benign 0.14
R2318:Prr14l UTSW 5 32830078 missense probably benign 0.04
R2915:Prr14l UTSW 5 32829768 missense probably benign 0.04
R3551:Prr14l UTSW 5 32828619 splice site probably null
R3820:Prr14l UTSW 5 32828984 missense probably damaging 0.99
R3852:Prr14l UTSW 5 32830345 missense probably damaging 1.00
R4126:Prr14l UTSW 5 32828003 missense probably damaging 0.97
R4345:Prr14l UTSW 5 32828576 missense probably damaging 1.00
R4388:Prr14l UTSW 5 32829254 missense probably damaging 1.00
R4575:Prr14l UTSW 5 32793644 missense probably damaging 1.00
R4596:Prr14l UTSW 5 32829308 missense probably benign 0.01
R4690:Prr14l UTSW 5 32844156 intron probably benign
R4824:Prr14l UTSW 5 32844399 intron probably benign
R4868:Prr14l UTSW 5 32829937 missense probably benign 0.04
R4869:Prr14l UTSW 5 32828833 missense probably damaging 1.00
R5201:Prr14l UTSW 5 32830247 missense possibly damaging 0.52
R5328:Prr14l UTSW 5 32830021 missense probably benign 0.00
R5410:Prr14l UTSW 5 32827777 missense probably damaging 0.98
R5476:Prr14l UTSW 5 32844138 intron probably benign
R5623:Prr14l UTSW 5 32844508 intron probably benign
R5730:Prr14l UTSW 5 32793603 missense probably damaging 1.00
R5988:Prr14l UTSW 5 32830851 missense probably damaging 0.98
R6261:Prr14l UTSW 5 32829404 missense possibly damaging 0.46
R6283:Prr14l UTSW 5 32830264 missense probably benign 0.14
R6307:Prr14l UTSW 5 32827525 missense probably damaging 0.97
R6825:Prr14l UTSW 5 32828548 missense possibly damaging 0.86
R6862:Prr14l UTSW 5 32827759 missense probably damaging 1.00
R6880:Prr14l UTSW 5 32830867 missense probably benign 0.01
R6931:Prr14l UTSW 5 32830691 missense probably damaging 0.98
R7101:Prr14l UTSW 5 32829427 missense probably damaging 1.00
R7164:Prr14l UTSW 5 32829166 missense probably damaging 1.00
R7203:Prr14l UTSW 5 32827145 missense probably benign 0.34
R7211:Prr14l UTSW 5 32830087 missense probably damaging 0.98
R7305:Prr14l UTSW 5 32831101 missense probably benign 0.14
R7346:Prr14l UTSW 5 32830684 missense probably benign 0.17
R7395:Prr14l UTSW 5 32828638 missense probably benign 0.00
R7624:Prr14l UTSW 5 32829623 missense possibly damaging 0.54
R7753:Prr14l UTSW 5 32827253 missense probably damaging 1.00
R7828:Prr14l UTSW 5 32844391 intron probably benign
R7898:Prr14l UTSW 5 32829966 missense probably benign 0.04
R8071:Prr14l UTSW 5 32831164 missense probably benign 0.02
R9052:Prr14l UTSW 5 32830134 nonsense probably null
R9136:Prr14l UTSW 5 32828736 missense
Predicted Primers PCR Primer
(F):5'- TACATGGGCTGAGAAGTCTGTG -3'
(R):5'- CAGGATAAGCAACCTGTGGC -3'

Sequencing Primer
(F):5'- TGGGTTAGAGAAACTCTTTCCAC -3'
(R):5'- TGGCTGACCAAGATGAGTCCATC -3'
Posted On 2019-10-24