Incidental Mutation 'R7649:AW146154'
ID590694
Institutional Source Beutler Lab
Gene Symbol AW146154
Ensembl Gene ENSMUSG00000074166
Gene Nameexpressed sequence AW146154
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R7649 (G1)
Quality Score81.0075
Status Validated
Chromosome7
Chromosomal Location41478874-41499890 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 41480732 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 320 (T320I)
Ref Sequence ENSEMBL: ENSMUSP00000096109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094532] [ENSMUST00000098509]
Predicted Effect probably benign
Transcript: ENSMUST00000094532
Predicted Effect probably benign
Transcript: ENSMUST00000098509
AA Change: T320I

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000096109
Gene: ENSMUSG00000074166
AA Change: T320I

DomainStartEndE-ValueType
KRAB 4 66 9.86e-14 SMART
ZnF_C2H2 75 97 9.08e1 SMART
ZnF_C2H2 131 153 7.78e-3 SMART
ZnF_C2H2 159 181 4.72e-2 SMART
ZnF_C2H2 187 209 3.63e-3 SMART
ZnF_C2H2 215 237 8.47e-4 SMART
ZnF_C2H2 243 265 4.24e-4 SMART
ZnF_C2H2 271 293 5.81e-2 SMART
ZnF_C2H2 299 321 2.61e-4 SMART
ZnF_C2H2 327 349 2.12e-4 SMART
ZnF_C2H2 355 377 1.6e-4 SMART
ZnF_C2H2 383 405 8.47e-4 SMART
ZnF_C2H2 411 433 6.88e-4 SMART
ZnF_C2H2 439 461 1.6e-4 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr3b T C 5: 25,848,366 V319A probably benign Het
Adam28 T A 14: 68,634,833 Y320F probably benign Het
Adam4 T C 12: 81,420,377 Y490C probably damaging Het
Ampd3 G T 7: 110,777,842 L13F probably benign Het
Arhgap45 C A 10: 80,031,001 Q1113K probably benign Het
Arid5b T C 10: 68,118,345 T370A possibly damaging Het
Arl15 A G 13: 113,967,672 D115G possibly damaging Het
Cdh17 C T 4: 11,814,698 P751L probably damaging Het
Chchd4 C T 6: 91,467,772 R11Q probably benign Het
Clta T G 4: 44,025,494 I140R possibly damaging Het
Cnpy1 T C 5: 28,207,284 T84A probably benign Het
Cpne5 T C 17: 29,226,198 D44G probably damaging Het
Crkl T C 16: 17,452,502 S9P unknown Het
Csmd3 T C 15: 47,669,143 D1641G Het
Ctnnd2 A G 15: 31,027,484 T1185A probably benign Het
Dlc1 A T 8: 36,582,740 L607Q probably damaging Het
Dpy19l2 T C 9: 24,696,163 M1V probably null Het
Dst T C 1: 34,167,697 V982A probably benign Het
Fam135b T C 15: 71,462,580 I922V probably benign Het
Fbxl13 T C 5: 21,614,666 E245G probably benign Het
Fcgbp T C 7: 28,091,503 S730P possibly damaging Het
Ggt1 T C 10: 75,585,456 V468A possibly damaging Het
Gja5 A T 3: 97,051,641 H338L probably benign Het
Herpud2 T C 9: 25,110,606 E248G possibly damaging Het
Il17rd C A 14: 27,039,210 A36E probably benign Het
Irf2bpl T C 12: 86,882,798 Y367C possibly damaging Het
Lama1 T A 17: 67,737,554 D149E Het
Lipf A T 19: 33,965,698 E135D possibly damaging Het
Manea T A 4: 26,328,234 D269V probably damaging Het
Megf6 A G 4: 154,265,085 Y910C probably damaging Het
Mical3 G A 6: 120,934,948 R1928W probably damaging Het
Olfr1462 T A 19: 13,190,772 I35N possibly damaging Het
Olfr273 G A 4: 52,855,692 Q274* probably null Het
Plch1 G T 3: 63,698,169 S1438* probably null Het
Por T C 5: 135,734,505 F595L probably damaging Het
Prkcg G A 7: 3,329,964 R634H probably benign Het
Prr14l C T 5: 32,828,245 G1302D probably benign Het
Rcan3 A T 4: 135,412,488 S135T probably benign Het
Rnf223 A G 4: 156,132,203 M12V probably benign Het
Rps6kb2 A G 19: 4,157,021 S483P unknown Het
Sacs T A 14: 61,203,228 F908I possibly damaging Het
Slc4a9 A G 18: 36,528,377 Q64R probably benign Het
Slco4c1 T A 1: 96,828,942 I552F probably benign Het
Sppl2b C T 10: 80,867,419 P505L probably benign Het
Sptbn4 A G 7: 27,361,577 S2434P possibly damaging Het
Ssh1 A T 5: 113,950,551 M395K probably benign Het
Stk10 A T 11: 32,577,764 I171F Het
Tmx3 C T 18: 90,540,030 A402V probably damaging Het
Tnfrsf13c T C 15: 82,224,140 D58G possibly damaging Het
Tnk1 T C 11: 69,853,577 probably null Het
Trav14n-3 A T 14: 53,370,494 N94Y probably damaging Het
Trav5-4 A T 14: 53,704,445 K92* probably null Het
Tsga10 C T 1: 37,835,148 R190H unknown Het
Zfhx3 T C 8: 108,951,644 F3109L probably benign Het
Zfhx4 A G 3: 5,242,110 Y132C probably damaging Het
Zfp521 T C 18: 13,844,356 E1000G probably damaging Het
Other mutations in AW146154
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:AW146154 APN 7 41480459 missense probably damaging 1.00
R1351:AW146154 UTSW 7 41480454 missense probably damaging 1.00
R3763:AW146154 UTSW 7 41480370 missense probably damaging 1.00
R4829:AW146154 UTSW 7 41480633 missense possibly damaging 0.62
R4835:AW146154 UTSW 7 41480468 missense probably damaging 1.00
R5326:AW146154 UTSW 7 41481377 missense probably benign 0.00
R5542:AW146154 UTSW 7 41481377 missense probably benign 0.00
R5976:AW146154 UTSW 7 41480297 missense probably damaging 0.99
R6252:AW146154 UTSW 7 41481387 missense probably benign 0.10
R7006:AW146154 UTSW 7 41481224 missense possibly damaging 0.50
R7053:AW146154 UTSW 7 41482564 critical splice donor site probably null
R7096:AW146154 UTSW 7 41481443 missense probably benign 0.32
R8069:AW146154 UTSW 7 41480511 missense probably benign 0.01
R8085:AW146154 UTSW 7 41481197 missense possibly damaging 0.61
R8085:AW146154 UTSW 7 41481198 missense probably damaging 1.00
R8266:AW146154 UTSW 7 41481168 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACATCTGTAAGGTTTCTCTCCAGT -3'
(R):5'- CCCTATGAATGCAATCAATGTGGTC -3'

Sequencing Primer
(F):5'- GACGTGCAAAAGCTTTATCACACTG -3'
(R):5'- TGCAATCAATGTGGTCAAGCC -3'
Posted On2019-10-24