Incidental Mutation 'R7649:Dlc1'
ID590696
Institutional Source Beutler Lab
Gene Symbol Dlc1
Ensembl Gene ENSMUSG00000031523
Gene Namedeleted in liver cancer 1
SynonymsArhgap7, A730069N07Rik, STARD12, p122-RhoGAP
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7649 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location36567751-36953143 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36582740 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 607 (L607Q)
Ref Sequence ENSEMBL: ENSMUSP00000033923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033923] [ENSMUST00000098826] [ENSMUST00000163663]
Predicted Effect probably damaging
Transcript: ENSMUST00000033923
AA Change: L607Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033923
Gene: ENSMUSG00000031523
AA Change: L607Q

DomainStartEndE-ValueType
Pfam:SAM_2 15 76 2.2e-7 PFAM
low complexity region 154 174 N/A INTRINSIC
low complexity region 238 250 N/A INTRINSIC
low complexity region 298 325 N/A INTRINSIC
low complexity region 427 441 N/A INTRINSIC
RhoGAP 653 845 8.82e-59 SMART
START 887 1088 3.93e-59 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000098826
AA Change: L641Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096425
Gene: ENSMUSG00000031523
AA Change: L641Q

DomainStartEndE-ValueType
Pfam:SAM_2 49 110 5.9e-8 PFAM
low complexity region 188 208 N/A INTRINSIC
low complexity region 272 284 N/A INTRINSIC
low complexity region 332 359 N/A INTRINSIC
low complexity region 461 475 N/A INTRINSIC
RhoGAP 687 879 8.82e-59 SMART
START 921 1122 3.93e-59 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163663
AA Change: L1058Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132812
Gene: ENSMUSG00000031523
AA Change: L1058Q

DomainStartEndE-ValueType
low complexity region 353 369 N/A INTRINSIC
low complexity region 388 403 N/A INTRINSIC
Pfam:SAM_2 466 527 1.2e-7 PFAM
low complexity region 605 625 N/A INTRINSIC
low complexity region 689 701 N/A INTRINSIC
low complexity region 749 776 N/A INTRINSIC
low complexity region 878 892 N/A INTRINSIC
RhoGAP 1104 1296 8.82e-59 SMART
START 1338 1539 3.93e-59 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GTPase-activating protein (GAP) that is a member of the rhoGAP family of proteins which play a role in the regulation of small GTP-binding proteins. GAP family proteins participate in signaling pathways that regulate cell processes involved in cytoskeletal changes. This gene functions as a tumor suppressor gene in a number of common cancers, including prostate, lung, colorectal, and breast cancers. Multiple transcript variants due to alternative promoters and alternative splicing have been found for this gene.[provided by RefSeq, Apr 2010]
PHENOTYPE: Homozygous mutants die by E10.5 with variable defects in the neural tube, heart, brain and placenta. Mouse embryonic fibroblasts homozygous for an activated conditional allele exhibti increased sensitivity to Ras-induced transformation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr3b T C 5: 25,848,366 V319A probably benign Het
Adam28 T A 14: 68,634,833 Y320F probably benign Het
Adam4 T C 12: 81,420,377 Y490C probably damaging Het
Ampd3 G T 7: 110,777,842 L13F probably benign Het
Arhgap45 C A 10: 80,031,001 Q1113K probably benign Het
Arid5b T C 10: 68,118,345 T370A possibly damaging Het
Arl15 A G 13: 113,967,672 D115G possibly damaging Het
AW146154 G A 7: 41,480,732 T320I probably benign Het
Cdh17 C T 4: 11,814,698 P751L probably damaging Het
Chchd4 C T 6: 91,467,772 R11Q probably benign Het
Clta T G 4: 44,025,494 I140R possibly damaging Het
Cnpy1 T C 5: 28,207,284 T84A probably benign Het
Cpne5 T C 17: 29,226,198 D44G probably damaging Het
Crkl T C 16: 17,452,502 S9P unknown Het
Csmd3 T C 15: 47,669,143 D1641G Het
Ctnnd2 A G 15: 31,027,484 T1185A probably benign Het
Dpy19l2 T C 9: 24,696,163 M1V probably null Het
Dst T C 1: 34,167,697 V982A probably benign Het
Fam135b T C 15: 71,462,580 I922V probably benign Het
Fbxl13 T C 5: 21,614,666 E245G probably benign Het
Fcgbp T C 7: 28,091,503 S730P possibly damaging Het
Ggt1 T C 10: 75,585,456 V468A possibly damaging Het
Gja5 A T 3: 97,051,641 H338L probably benign Het
Herpud2 T C 9: 25,110,606 E248G possibly damaging Het
Il17rd C A 14: 27,039,210 A36E probably benign Het
Irf2bpl T C 12: 86,882,798 Y367C possibly damaging Het
Lama1 T A 17: 67,737,554 D149E Het
Lipf A T 19: 33,965,698 E135D possibly damaging Het
Manea T A 4: 26,328,234 D269V probably damaging Het
Megf6 A G 4: 154,265,085 Y910C probably damaging Het
Mical3 G A 6: 120,934,948 R1928W probably damaging Het
Olfr1462 T A 19: 13,190,772 I35N possibly damaging Het
Olfr273 G A 4: 52,855,692 Q274* probably null Het
Plch1 G T 3: 63,698,169 S1438* probably null Het
Por T C 5: 135,734,505 F595L probably damaging Het
Prkcg G A 7: 3,329,964 R634H probably benign Het
Prr14l C T 5: 32,828,245 G1302D probably benign Het
Rcan3 A T 4: 135,412,488 S135T probably benign Het
Rnf223 A G 4: 156,132,203 M12V probably benign Het
Rps6kb2 A G 19: 4,157,021 S483P unknown Het
Sacs T A 14: 61,203,228 F908I possibly damaging Het
Slc4a9 A G 18: 36,528,377 Q64R probably benign Het
Slco4c1 T A 1: 96,828,942 I552F probably benign Het
Sppl2b C T 10: 80,867,419 P505L probably benign Het
Sptbn4 A G 7: 27,361,577 S2434P possibly damaging Het
Ssh1 A T 5: 113,950,551 M395K probably benign Het
Stk10 A T 11: 32,577,764 I171F Het
Tmx3 C T 18: 90,540,030 A402V probably damaging Het
Tnfrsf13c T C 15: 82,224,140 D58G possibly damaging Het
Tnk1 T C 11: 69,853,577 probably null Het
Trav14n-3 A T 14: 53,370,494 N94Y probably damaging Het
Trav5-4 A T 14: 53,704,445 K92* probably null Het
Tsga10 C T 1: 37,835,148 R190H unknown Het
Zfhx3 T C 8: 108,951,644 F3109L probably benign Het
Zfhx4 A G 3: 5,242,110 Y132C probably damaging Het
Zfp521 T C 18: 13,844,356 E1000G probably damaging Het
Other mutations in Dlc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Dlc1 APN 8 36570282 utr 3 prime probably benign
IGL00807:Dlc1 APN 8 36572848 missense probably benign 0.01
IGL00924:Dlc1 APN 8 36938214 missense probably benign
IGL01349:Dlc1 APN 8 36583824 missense probably damaging 0.96
IGL01419:Dlc1 APN 8 36850217 missense probably benign 0.02
IGL01871:Dlc1 APN 8 36850180 missense probably damaging 0.99
IGL01937:Dlc1 APN 8 36850191 missense probably benign 0.25
IGL02525:Dlc1 APN 8 36579646 missense probably damaging 1.00
IGL02696:Dlc1 APN 8 36574172 missense possibly damaging 0.65
IGL02826:Dlc1 APN 8 36570275 utr 3 prime probably benign
IGL03029:Dlc1 APN 8 36571262 splice site probably null
IGL02835:Dlc1 UTSW 8 36583901 missense probably damaging 1.00
R0068:Dlc1 UTSW 8 36937721 missense probably benign
R0068:Dlc1 UTSW 8 36937721 missense probably benign
R0164:Dlc1 UTSW 8 36599440 missense probably damaging 0.96
R0164:Dlc1 UTSW 8 36599440 missense probably damaging 0.96
R0218:Dlc1 UTSW 8 36850229 missense probably benign
R0419:Dlc1 UTSW 8 36583586 missense possibly damaging 0.69
R0513:Dlc1 UTSW 8 36584010 missense probably damaging 1.00
R0645:Dlc1 UTSW 8 36574049 missense possibly damaging 0.60
R0646:Dlc1 UTSW 8 36858051 missense probably benign
R0727:Dlc1 UTSW 8 36572674 missense probably damaging 0.99
R0792:Dlc1 UTSW 8 36938548 missense probably benign 0.00
R1061:Dlc1 UTSW 8 36858051 missense probably benign
R1221:Dlc1 UTSW 8 36584831 missense probably benign
R1440:Dlc1 UTSW 8 36593463 splice site probably benign
R1501:Dlc1 UTSW 8 36938148 missense probably benign 0.06
R1606:Dlc1 UTSW 8 36850252 missense probably benign
R1707:Dlc1 UTSW 8 36937609 missense probably benign 0.03
R1750:Dlc1 UTSW 8 36858090 splice site probably null
R1762:Dlc1 UTSW 8 36937585 missense probably benign 0.25
R2041:Dlc1 UTSW 8 36582768 missense probably damaging 1.00
R2055:Dlc1 UTSW 8 36593381 missense probably damaging 0.98
R2091:Dlc1 UTSW 8 36937609 missense probably benign 0.00
R2987:Dlc1 UTSW 8 36574152 missense probably damaging 0.97
R4285:Dlc1 UTSW 8 36574128 missense possibly damaging 0.49
R4294:Dlc1 UTSW 8 36584753 missense possibly damaging 0.47
R4631:Dlc1 UTSW 8 36937558 critical splice donor site probably null
R4828:Dlc1 UTSW 8 36850246 missense possibly damaging 0.69
R4867:Dlc1 UTSW 8 36584645 missense probably benign 0.01
R4902:Dlc1 UTSW 8 36577131 missense probably damaging 1.00
R5067:Dlc1 UTSW 8 36584493 missense probably benign 0.04
R5068:Dlc1 UTSW 8 36938030 missense probably benign
R5198:Dlc1 UTSW 8 36938398 missense probably damaging 1.00
R5471:Dlc1 UTSW 8 36584725 missense probably benign 0.26
R5668:Dlc1 UTSW 8 36937501 unclassified probably benign
R5915:Dlc1 UTSW 8 36938675 utr 5 prime probably benign
R6323:Dlc1 UTSW 8 36938383 missense possibly damaging 0.62
R6655:Dlc1 UTSW 8 36572716 missense probably damaging 1.00
R6908:Dlc1 UTSW 8 36937687 missense probably benign 0.02
R6914:Dlc1 UTSW 8 36938210 missense probably benign
R6942:Dlc1 UTSW 8 36938210 missense probably benign
R7269:Dlc1 UTSW 8 36579253 missense probably damaging 1.00
R7271:Dlc1 UTSW 8 36582800 missense probably damaging 0.99
R7462:Dlc1 UTSW 8 36937964 missense unknown
R7548:Dlc1 UTSW 8 36584655 missense probably benign 0.00
Z1176:Dlc1 UTSW 8 36584211 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGCATGGAGAACATAGCCTG -3'
(R):5'- TCAGAGATTGGTCCCAGCTC -3'

Sequencing Primer
(F):5'- TGGAGACCACCTGCTTAAAG -3'
(R):5'- GAGATTGGTCCCAGCTCACTCC -3'
Posted On2019-10-24