Incidental Mutation 'R7649:Adam28'
ID 590713
Institutional Source Beutler Lab
Gene Symbol Adam28
Ensembl Gene ENSMUSG00000014725
Gene Name a disintegrin and metallopeptidase domain 28
Synonyms MDC-L, D430033C21Rik, Dtgn1, C130072N01Rik
MMRRC Submission 045646-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.186) question?
Stock # R7649 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 68843476-68893291 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 68872282 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 320 (Y320F)
Ref Sequence ENSEMBL: ENSMUSP00000022642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022642] [ENSMUST00000111072] [ENSMUST00000224039]
AlphaFold Q9JLN6
Predicted Effect probably benign
Transcript: ENSMUST00000022642
AA Change: Y320F

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000022642
Gene: ENSMUSG00000014725
AA Change: Y320F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Pep_M12B_propep 31 158 5.5e-34 PFAM
Pfam:Reprolysin_4 205 387 1.5e-14 PFAM
Pfam:Reprolysin_5 205 388 9.7e-19 PFAM
Pfam:Reprolysin 206 402 5.6e-70 PFAM
Pfam:Reprolysin_2 226 392 1e-16 PFAM
Pfam:Reprolysin_3 230 353 1.2e-21 PFAM
DISIN 419 494 2.1e-36 SMART
ACR 495 623 1.84e-52 SMART
EGF 631 660 3.01e0 SMART
transmembrane domain 667 689 N/A INTRINSIC
low complexity region 738 753 N/A INTRINSIC
low complexity region 757 765 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111072
AA Change: Y320F

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000106701
Gene: ENSMUSG00000014725
AA Change: Y320F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Pep_M12B_propep 31 158 5.3e-34 PFAM
Pfam:Reprolysin_4 205 387 1.5e-14 PFAM
Pfam:Reprolysin_5 205 388 9.3e-19 PFAM
Pfam:Reprolysin 206 402 5.3e-70 PFAM
Pfam:Reprolysin_2 226 392 9.9e-17 PFAM
Pfam:Reprolysin_3 230 353 1.1e-21 PFAM
DISIN 419 494 2.1e-36 SMART
ACR 495 623 1.84e-52 SMART
EGF 631 660 3.01e0 SMART
transmembrane domain 667 689 N/A INTRINSIC
low complexity region 738 753 N/A INTRINSIC
low complexity region 757 765 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224039
AA Change: Y320F

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are typically membrane-anchored, although a form of this protein may be secreted. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate a mature protein product. This protein may bind to integrins and regulate lymphocyte migration by enhancing cell adhesion. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr3b T C 5: 26,053,364 (GRCm39) V319A probably benign Het
Adam4 T C 12: 81,467,151 (GRCm39) Y490C probably damaging Het
Ampd3 G T 7: 110,377,049 (GRCm39) L13F probably benign Het
Arhgap45 C A 10: 79,866,835 (GRCm39) Q1113K probably benign Het
Arid5b T C 10: 67,954,175 (GRCm39) T370A possibly damaging Het
Arl15 A G 13: 114,104,208 (GRCm39) D115G possibly damaging Het
AW146154 G A 7: 41,130,156 (GRCm39) T320I probably benign Het
Cdh17 C T 4: 11,814,698 (GRCm39) P751L probably damaging Het
Chchd4 C T 6: 91,444,754 (GRCm39) R11Q probably benign Het
Clta T G 4: 44,025,494 (GRCm39) I140R possibly damaging Het
Cnpy1 T C 5: 28,412,282 (GRCm39) T84A probably benign Het
Cpne5 T C 17: 29,445,172 (GRCm39) D44G probably damaging Het
Crkl T C 16: 17,270,366 (GRCm39) S9P unknown Het
Csmd3 T C 15: 47,532,539 (GRCm39) D1641G Het
Ctnnd2 A G 15: 31,027,630 (GRCm39) T1185A probably benign Het
Dlc1 A T 8: 37,049,894 (GRCm39) L607Q probably damaging Het
Dpy19l2 T C 9: 24,607,459 (GRCm39) M1V probably null Het
Dst T C 1: 34,206,778 (GRCm39) V982A probably benign Het
Fam135b T C 15: 71,334,429 (GRCm39) I922V probably benign Het
Fbxl13 T C 5: 21,819,664 (GRCm39) E245G probably benign Het
Fcgbp T C 7: 27,790,928 (GRCm39) S730P possibly damaging Het
Ggt1 T C 10: 75,421,290 (GRCm39) V468A possibly damaging Het
Gja5 A T 3: 96,958,957 (GRCm39) H338L probably benign Het
Herpud2 T C 9: 25,021,902 (GRCm39) E248G possibly damaging Het
Il17rd C A 14: 26,761,167 (GRCm39) A36E probably benign Het
Irf2bpl T C 12: 86,929,572 (GRCm39) Y367C possibly damaging Het
Lama1 T A 17: 68,044,549 (GRCm39) D149E Het
Lipf A T 19: 33,943,098 (GRCm39) E135D possibly damaging Het
Manea T A 4: 26,328,234 (GRCm39) D269V probably damaging Het
Megf6 A G 4: 154,349,542 (GRCm39) Y910C probably damaging Het
Mical3 G A 6: 120,911,909 (GRCm39) R1928W probably damaging Het
Or13c3 G A 4: 52,855,692 (GRCm39) Q274* probably null Het
Or5b108 T A 19: 13,168,136 (GRCm39) I35N possibly damaging Het
Plch1 G T 3: 63,605,590 (GRCm39) S1438* probably null Het
Por T C 5: 135,763,359 (GRCm39) F595L probably damaging Het
Prkcg G A 7: 3,378,480 (GRCm39) R634H probably benign Het
Prr14l C T 5: 32,985,589 (GRCm39) G1302D probably benign Het
Rcan3 A T 4: 135,139,799 (GRCm39) S135T probably benign Het
Rnf223 A G 4: 156,216,660 (GRCm39) M12V probably benign Het
Rps6kb2 A G 19: 4,207,020 (GRCm39) S483P unknown Het
Sacs T A 14: 61,440,677 (GRCm39) F908I possibly damaging Het
Slc4a9 A G 18: 36,661,430 (GRCm39) Q64R probably benign Het
Slco4c1 T A 1: 96,756,667 (GRCm39) I552F probably benign Het
Sppl2b C T 10: 80,703,253 (GRCm39) P505L probably benign Het
Sptbn4 A G 7: 27,061,002 (GRCm39) S2434P possibly damaging Het
Ssh1 A T 5: 114,088,612 (GRCm39) M395K probably benign Het
Stk10 A T 11: 32,527,764 (GRCm39) I171F Het
Tmx3 C T 18: 90,558,154 (GRCm39) A402V probably damaging Het
Tnfrsf13c T C 15: 82,108,341 (GRCm39) D58G possibly damaging Het
Tnk1 T C 11: 69,744,403 (GRCm39) probably null Het
Trav14n-3 A T 14: 53,607,951 (GRCm39) N94Y probably damaging Het
Trav5-4 A T 14: 53,941,902 (GRCm39) K92* probably null Het
Tsga10 C T 1: 37,874,229 (GRCm39) R190H unknown Het
Zfhx3 T C 8: 109,678,276 (GRCm39) F3109L probably benign Het
Zfhx4 A G 3: 5,307,170 (GRCm39) Y132C probably damaging Het
Zfp521 T C 18: 13,977,413 (GRCm39) E1000G probably damaging Het
Other mutations in Adam28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Adam28 APN 14 68,859,569 (GRCm39) missense possibly damaging 0.47
IGL00654:Adam28 APN 14 68,886,877 (GRCm39) missense probably benign 0.00
IGL01021:Adam28 APN 14 68,879,563 (GRCm39) missense probably benign
IGL01099:Adam28 APN 14 68,874,778 (GRCm39) critical splice donor site probably null
IGL01349:Adam28 APN 14 68,848,455 (GRCm39) missense probably benign 0.01
IGL01744:Adam28 APN 14 68,844,956 (GRCm39) missense probably benign 0.07
IGL01805:Adam28 APN 14 68,879,540 (GRCm39) missense probably benign 0.09
IGL02007:Adam28 APN 14 68,870,668 (GRCm39) missense possibly damaging 0.69
IGL02828:Adam28 APN 14 68,884,319 (GRCm39) missense possibly damaging 0.46
IGL03180:Adam28 APN 14 68,874,883 (GRCm39) missense probably damaging 1.00
IGL03355:Adam28 APN 14 68,872,252 (GRCm39) splice site probably benign
IGL02980:Adam28 UTSW 14 68,857,255 (GRCm39) missense probably benign 0.01
PIT4453001:Adam28 UTSW 14 68,872,325 (GRCm39) missense probably benign 0.00
R0184:Adam28 UTSW 14 68,874,822 (GRCm39) missense probably benign 0.33
R0321:Adam28 UTSW 14 68,855,200 (GRCm39) missense probably damaging 0.97
R0329:Adam28 UTSW 14 68,855,188 (GRCm39) missense probably damaging 0.96
R0494:Adam28 UTSW 14 68,868,241 (GRCm39) splice site probably benign
R0605:Adam28 UTSW 14 68,844,049 (GRCm39) unclassified probably benign
R0732:Adam28 UTSW 14 68,874,796 (GRCm39) missense probably benign 0.00
R0959:Adam28 UTSW 14 68,845,387 (GRCm39) missense possibly damaging 0.93
R1319:Adam28 UTSW 14 68,846,578 (GRCm39) missense probably benign 0.28
R1745:Adam28 UTSW 14 68,870,620 (GRCm39) missense probably benign 0.04
R1836:Adam28 UTSW 14 68,886,870 (GRCm39) missense possibly damaging 0.85
R1838:Adam28 UTSW 14 68,876,659 (GRCm39) missense possibly damaging 0.53
R1839:Adam28 UTSW 14 68,876,659 (GRCm39) missense possibly damaging 0.53
R1850:Adam28 UTSW 14 68,876,644 (GRCm39) missense probably benign 0.01
R1912:Adam28 UTSW 14 68,881,780 (GRCm39) missense probably benign 0.24
R2830:Adam28 UTSW 14 68,864,363 (GRCm39) missense possibly damaging 0.65
R2889:Adam28 UTSW 14 68,872,294 (GRCm39) missense possibly damaging 0.85
R3977:Adam28 UTSW 14 68,848,443 (GRCm39) missense probably benign 0.20
R3978:Adam28 UTSW 14 68,848,443 (GRCm39) missense probably benign 0.20
R3979:Adam28 UTSW 14 68,848,443 (GRCm39) missense probably benign 0.20
R4282:Adam28 UTSW 14 68,885,155 (GRCm39) missense possibly damaging 0.92
R4416:Adam28 UTSW 14 68,859,531 (GRCm39) critical splice donor site probably null
R4690:Adam28 UTSW 14 68,879,497 (GRCm39) missense probably benign 0.01
R4724:Adam28 UTSW 14 68,864,326 (GRCm39) missense probably damaging 0.99
R4768:Adam28 UTSW 14 68,872,264 (GRCm39) missense possibly damaging 0.46
R4883:Adam28 UTSW 14 68,875,552 (GRCm39) missense probably damaging 0.99
R5054:Adam28 UTSW 14 68,855,164 (GRCm39) missense probably damaging 1.00
R5710:Adam28 UTSW 14 68,847,357 (GRCm39) missense probably damaging 0.96
R5835:Adam28 UTSW 14 68,893,130 (GRCm39) missense possibly damaging 0.96
R6002:Adam28 UTSW 14 68,879,511 (GRCm39) missense probably benign
R6054:Adam28 UTSW 14 68,879,601 (GRCm39) missense probably benign 0.01
R6349:Adam28 UTSW 14 68,870,621 (GRCm39) missense probably benign 0.29
R6449:Adam28 UTSW 14 68,868,116 (GRCm39) missense probably benign 0.31
R6455:Adam28 UTSW 14 68,870,657 (GRCm39) missense probably damaging 1.00
R6831:Adam28 UTSW 14 68,855,576 (GRCm39) missense probably benign 0.04
R6833:Adam28 UTSW 14 68,855,576 (GRCm39) missense probably benign 0.04
R7212:Adam28 UTSW 14 68,874,846 (GRCm39) missense probably damaging 0.99
R7411:Adam28 UTSW 14 68,864,396 (GRCm39) missense probably damaging 1.00
R7422:Adam28 UTSW 14 68,864,326 (GRCm39) missense probably damaging 1.00
R7516:Adam28 UTSW 14 68,868,125 (GRCm39) missense probably damaging 1.00
R7765:Adam28 UTSW 14 68,846,555 (GRCm39) critical splice donor site probably null
R8469:Adam28 UTSW 14 68,844,029 (GRCm39) missense probably benign 0.16
R8520:Adam28 UTSW 14 68,879,532 (GRCm39) missense probably damaging 0.98
R9026:Adam28 UTSW 14 68,846,593 (GRCm39) missense probably benign 0.16
R9163:Adam28 UTSW 14 68,866,531 (GRCm39) missense probably damaging 0.98
R9264:Adam28 UTSW 14 68,844,914 (GRCm39) missense probably benign
R9304:Adam28 UTSW 14 68,874,946 (GRCm39) missense probably damaging 1.00
R9357:Adam28 UTSW 14 68,879,479 (GRCm39) missense probably benign 0.36
R9441:Adam28 UTSW 14 68,874,943 (GRCm39) missense probably damaging 0.96
Z1177:Adam28 UTSW 14 68,864,233 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCAATCGATTTTGCTCATTGAAA -3'
(R):5'- AGTGATCGTTGGAAACTTAAATTTCTC -3'

Sequencing Primer
(F):5'- ACTGCCCTTGAGTCTAGAATGCAG -3'
(R):5'- CTAGTCCCTGTTTAGACTTCTAAAGG -3'
Posted On 2019-10-24