Incidental Mutation 'R0234:Itsn1'
ID59072
Institutional Source Beutler Lab
Gene Symbol Itsn1
Ensembl Gene ENSMUSG00000022957
Gene Nameintersectin 1 (SH3 domain protein 1A)
SynonymsIntersectin-L, EHSH1, Eh domain, SH3 domain regulator of endocytosis 1, Ese1, Sh3p17
MMRRC Submission 038475-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0234 (G1)
Quality Score216
Status Not validated
Chromosome16
Chromosomal Location91729281-91920597 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 91828280 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 590 (R590*)
Ref Sequence ENSEMBL: ENSMUSP00000109635 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056482] [ENSMUST00000064797] [ENSMUST00000095909] [ENSMUST00000113993] [ENSMUST00000113996] [ENSMUST00000113999] [ENSMUST00000114001] [ENSMUST00000114002] [ENSMUST00000159295]
PDB Structure
Intersectin 1-peptide-AP2 alpha ear complex [X-RAY DIFFRACTION]
Structure of SH3E-DH unit of murine intersectin-1L [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000056482
AA Change: R590*
SMART Domains Protein: ENSMUSP00000056011
Gene: ENSMUSG00000022957
AA Change: R590*

DomainStartEndE-ValueType
EH 14 108 1.34e-43 SMART
EFh 57 85 2.14e-1 SMART
low complexity region 138 165 N/A INTRINSIC
low complexity region 182 192 N/A INTRINSIC
EH 214 309 2.55e-49 SMART
EFh 258 286 1.77e-2 SMART
low complexity region 330 342 N/A INTRINSIC
coiled coil region 352 447 N/A INTRINSIC
coiled coil region 468 515 N/A INTRINSIC
low complexity region 526 537 N/A INTRINSIC
coiled coil region 561 661 N/A INTRINSIC
low complexity region 687 696 N/A INTRINSIC
SH3 741 798 1.05e-19 SMART
SH3 909 963 2.64e-16 SMART
SH3 998 1052 1.82e-19 SMART
SH3 1070 1130 2.46e-16 SMART
SH3 1151 1206 7.97e-25 SMART
Predicted Effect probably null
Transcript: ENSMUST00000064797
AA Change: R590*
SMART Domains Protein: ENSMUSP00000066361
Gene: ENSMUSG00000022957
AA Change: R590*

DomainStartEndE-ValueType
EH 14 108 1.34e-43 SMART
EFh 57 85 2.14e-1 SMART
low complexity region 138 165 N/A INTRINSIC
low complexity region 182 192 N/A INTRINSIC
EH 214 309 2.55e-49 SMART
EFh 258 286 1.77e-2 SMART
low complexity region 330 342 N/A INTRINSIC
coiled coil region 352 447 N/A INTRINSIC
coiled coil region 468 515 N/A INTRINSIC
low complexity region 526 537 N/A INTRINSIC
coiled coil region 561 661 N/A INTRINSIC
low complexity region 687 696 N/A INTRINSIC
SH3 741 803 1.62e-16 SMART
SH3 914 968 2.64e-16 SMART
SH3 1003 1057 1.82e-19 SMART
SH3 1075 1135 2.46e-16 SMART
SH3 1156 1211 7.97e-25 SMART
RhoGEF 1239 1420 1e-63 SMART
PH 1461 1571 6.07e-13 SMART
C2 1595 1692 1.58e-18 SMART
Predicted Effect probably null
Transcript: ENSMUST00000095909
AA Change: R590*
SMART Domains Protein: ENSMUSP00000093598
Gene: ENSMUSG00000022957
AA Change: R590*

DomainStartEndE-ValueType
EH 14 108 1.34e-43 SMART
EFh 57 85 2.14e-1 SMART
low complexity region 138 165 N/A INTRINSIC
low complexity region 182 192 N/A INTRINSIC
EH 214 309 2.55e-49 SMART
EFh 258 286 1.77e-2 SMART
low complexity region 330 342 N/A INTRINSIC
coiled coil region 352 447 N/A INTRINSIC
coiled coil region 468 515 N/A INTRINSIC
low complexity region 526 537 N/A INTRINSIC
coiled coil region 561 607 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113993
AA Change: R590*
SMART Domains Protein: ENSMUSP00000109626
Gene: ENSMUSG00000022957
AA Change: R590*

DomainStartEndE-ValueType
EH 14 108 1.34e-43 SMART
EFh 57 85 2.14e-1 SMART
low complexity region 138 165 N/A INTRINSIC
low complexity region 182 192 N/A INTRINSIC
EH 214 309 2.55e-49 SMART
EFh 258 286 1.77e-2 SMART
low complexity region 330 342 N/A INTRINSIC
coiled coil region 352 447 N/A INTRINSIC
coiled coil region 468 515 N/A INTRINSIC
low complexity region 526 537 N/A INTRINSIC
coiled coil region 561 661 N/A INTRINSIC
low complexity region 687 696 N/A INTRINSIC
SH3 741 803 1.62e-16 SMART
SH3 914 968 2.64e-16 SMART
SH3 1004 1064 2.46e-16 SMART
SH3 1085 1140 7.97e-25 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113996
AA Change: R590*
SMART Domains Protein: ENSMUSP00000109629
Gene: ENSMUSG00000022957
AA Change: R590*

DomainStartEndE-ValueType
EH 14 108 1.34e-43 SMART
EFh 57 85 2.14e-1 SMART
low complexity region 138 165 N/A INTRINSIC
low complexity region 182 192 N/A INTRINSIC
EH 214 309 2.55e-49 SMART
EFh 258 286 1.77e-2 SMART
low complexity region 330 342 N/A INTRINSIC
coiled coil region 352 447 N/A INTRINSIC
coiled coil region 468 515 N/A INTRINSIC
low complexity region 526 537 N/A INTRINSIC
coiled coil region 561 661 N/A INTRINSIC
low complexity region 687 696 N/A INTRINSIC
SH3 741 798 1.05e-19 SMART
SH3 909 963 2.64e-16 SMART
SH3 999 1059 2.46e-16 SMART
SH3 1080 1135 7.97e-25 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113999
AA Change: R590*
SMART Domains Protein: ENSMUSP00000109632
Gene: ENSMUSG00000022957
AA Change: R590*

DomainStartEndE-ValueType
EH 14 108 1.34e-43 SMART
EFh 57 85 2.14e-1 SMART
low complexity region 138 165 N/A INTRINSIC
low complexity region 182 192 N/A INTRINSIC
EH 214 309 2.55e-49 SMART
EFh 258 286 1.77e-2 SMART
low complexity region 330 342 N/A INTRINSIC
coiled coil region 352 447 N/A INTRINSIC
coiled coil region 468 515 N/A INTRINSIC
low complexity region 526 537 N/A INTRINSIC
coiled coil region 561 661 N/A INTRINSIC
low complexity region 687 696 N/A INTRINSIC
SH3 741 803 1.62e-16 SMART
SH3 914 968 2.64e-16 SMART
SH3 1003 1057 1.82e-19 SMART
SH3 1075 1135 2.46e-16 SMART
SH3 1156 1211 7.97e-25 SMART
Predicted Effect probably null
Transcript: ENSMUST00000114001
AA Change: R553*
SMART Domains Protein: ENSMUSP00000109634
Gene: ENSMUSG00000022957
AA Change: R553*

DomainStartEndE-ValueType
EH 14 108 1.34e-43 SMART
EFh 57 85 2.14e-1 SMART
low complexity region 145 155 N/A INTRINSIC
EH 177 272 2.55e-49 SMART
EFh 221 249 1.77e-2 SMART
low complexity region 293 305 N/A INTRINSIC
coiled coil region 315 410 N/A INTRINSIC
coiled coil region 431 478 N/A INTRINSIC
low complexity region 489 500 N/A INTRINSIC
coiled coil region 524 624 N/A INTRINSIC
low complexity region 650 659 N/A INTRINSIC
SH3 704 761 1.05e-19 SMART
SH3 872 926 2.64e-16 SMART
SH3 961 1015 1.82e-19 SMART
SH3 1033 1093 2.46e-16 SMART
SH3 1114 1169 7.97e-25 SMART
Predicted Effect probably null
Transcript: ENSMUST00000114002
AA Change: R590*
SMART Domains Protein: ENSMUSP00000109635
Gene: ENSMUSG00000022957
AA Change: R590*

DomainStartEndE-ValueType
EH 14 108 1.34e-43 SMART
EFh 57 85 2.14e-1 SMART
low complexity region 138 165 N/A INTRINSIC
low complexity region 182 192 N/A INTRINSIC
EH 214 309 2.55e-49 SMART
EFh 258 286 1.77e-2 SMART
low complexity region 330 342 N/A INTRINSIC
coiled coil region 352 447 N/A INTRINSIC
coiled coil region 468 515 N/A INTRINSIC
low complexity region 526 537 N/A INTRINSIC
coiled coil region 561 661 N/A INTRINSIC
low complexity region 687 696 N/A INTRINSIC
SH3 741 798 1.05e-19 SMART
SH3 909 963 2.64e-16 SMART
SH3 998 1052 1.82e-19 SMART
SH3 1070 1130 2.46e-16 SMART
SH3 1151 1206 7.97e-25 SMART
RhoGEF 1234 1415 1e-63 SMART
PH 1456 1566 6.07e-13 SMART
C2 1590 1687 1.58e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133389
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144101
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151044
Predicted Effect probably benign
Transcript: ENSMUST00000159295
SMART Domains Protein: ENSMUSP00000125172
Gene: ENSMUSG00000116933

DomainStartEndE-ValueType
Pfam:OSCP 1 89 1.1e-16 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytoplasmic membrane-associated protein that indirectly coordinates endocytic membrane traffic with the actin assembly machinery. In addition, the encoded protein may regulate the formation of clathrin-coated vesicles and could be involved in synaptic vesicle recycling. This protein has been shown to interact with dynamin, CDC42, SNAP23, SNAP25, SPIN90, EPS15, EPN1, EPN2, and STN2. Multiple transcript variants encoding different isoforms have been found for this gene, but the full-length nature of only two of them have been characterized so far. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous for a gene trapped allele exhibit embryonic lethal. Mice homozygous for a null allele exhibit some postnatal lethality and impaired vesicle recycling in surviving mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik T A 7: 131,194,303 probably null Het
A3galt2 A G 4: 128,767,148 R197G possibly damaging Het
Acacb A T 5: 114,209,817 H983L probably damaging Het
Adal T A 2: 121,148,317 D139E probably benign Het
Adam6b G A 12: 113,490,610 R349H probably damaging Het
Agap1 A G 1: 89,671,212 K331E probably damaging Het
Alyref T C 11: 120,598,307 D11G probably damaging Het
B3gat1 A G 9: 26,756,081 E203G probably damaging Het
Bsn T C 9: 108,116,396 E719G possibly damaging Het
Cap2 G C 13: 46,638,022 probably null Het
Ccni A G 5: 93,202,327 V31A probably benign Het
Cfap54 A T 10: 92,899,160 L2343* probably null Het
Clns1a T A 7: 97,714,032 Y204N possibly damaging Het
Cox11 C T 11: 90,644,500 T259I probably damaging Het
D430042O09Rik T C 7: 125,795,385 V211A probably benign Het
Dsp A G 13: 38,187,893 N940S probably benign Het
Erbb2 T C 11: 98,436,439 V1181A probably benign Het
Exoc4 T C 6: 33,862,087 V686A possibly damaging Het
F830045P16Rik A G 2: 129,463,464 V330A possibly damaging Het
Fam71a T C 1: 191,162,908 S513G probably benign Het
Fbf1 A C 11: 116,155,034 F245V probably damaging Het
Fut10 T A 8: 31,236,197 F327I probably damaging Het
Galnt1 C T 18: 24,254,633 P144S probably damaging Het
Ghrhr A T 6: 55,379,186 D88V possibly damaging Het
Greb1l T A 18: 10,560,331 C1864S probably damaging Het
Hist1h1c T C 13: 23,739,123 I92T probably benign Het
Hps1 T C 19: 42,762,553 E336G probably damaging Het
Ibsp GGAAGAAGAAGAAGAAGA GGAAGAAGAAGAAGA 5: 104,310,069 probably benign Het
Irgc1 C A 7: 24,433,328 E21D possibly damaging Het
Lmln T C 16: 33,066,324 V67A probably damaging Het
Lsm14a T C 7: 34,365,617 Q179R probably damaging Het
Ltbr A C 6: 125,312,873 D119E probably benign Het
Mrc1 A G 2: 14,279,894 T565A possibly damaging Het
Muc6 A C 7: 141,649,674 N473K possibly damaging Het
Myocd A T 11: 65,187,240 D448E probably benign Het
Neil2 T A 14: 63,183,526 I239F probably damaging Het
Npnt A G 3: 132,914,414 F123S possibly damaging Het
Olfr1164 T A 2: 88,093,022 R305* probably null Het
Olfr117 T A 17: 37,660,106 I76F probably damaging Het
Olfr1309 T C 2: 111,983,300 Y258C probably damaging Het
Olfr1501 C T 19: 13,838,538 V212M possibly damaging Het
Olfr683 T C 7: 105,144,074 D73G probably damaging Het
Olfr686 C A 7: 105,203,614 C243F probably damaging Het
Olfr933 A C 9: 38,976,251 probably null Het
Pcnx3 T C 19: 5,672,618 T941A probably benign Het
Phldb3 G A 7: 24,612,579 R106Q probably benign Het
Pitrm1 C A 13: 6,575,079 Y864* probably null Het
Plcb4 T C 2: 135,982,075 I844T probably benign Het
Plekhg5 T C 4: 152,112,219 C695R probably damaging Het
Ppp1r3b T A 8: 35,384,501 F165I probably damaging Het
Prr5 T A 15: 84,703,121 F357L probably damaging Het
Rasgrf1 A T 9: 90,009,366 I1046F probably damaging Het
Rbm15b T C 9: 106,885,364 Y535C probably damaging Het
Rbp3 A T 14: 33,955,901 E602V probably damaging Het
Rimklb T C 6: 122,456,333 N343S probably benign Het
Rrp12 A G 19: 41,871,760 L1008P probably damaging Het
Sec63 C T 10: 42,798,798 R226C probably damaging Het
Sirpa T C 2: 129,615,468 V154A probably damaging Het
Slc13a5 C G 11: 72,250,800 V405L probably damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc22a23 G A 13: 34,183,261 T588I probably damaging Het
Slc22a27 C A 19: 7,926,791 probably benign Het
Slc4a4 A C 5: 89,156,336 H502P possibly damaging Het
Slc5a5 A T 8: 70,889,633 M258K probably damaging Het
Spry4 A G 18: 38,590,089 I207T possibly damaging Het
Stk11ip A G 1: 75,529,067 D460G possibly damaging Het
Syn3 T A 10: 86,448,886 I117F possibly damaging Het
Tead4 C T 6: 128,243,402 A224T probably damaging Het
Tmtc3 A T 10: 100,450,322 N546K probably benign Het
Tnn T A 1: 160,088,466 H1227L probably damaging Het
Tor2a G A 2: 32,758,704 G62D probably damaging Het
Trf T C 9: 103,226,879 probably null Het
Ubr5 T C 15: 37,968,493 T2727A probably damaging Het
Vmn2r27 T A 6: 124,231,619 T56S probably benign Het
Wipf3 T G 6: 54,496,501 L458R probably damaging Het
Zfp236 T C 18: 82,629,994 K966R probably damaging Het
Zfp27 T A 7: 29,894,107 H811L possibly damaging Het
Zfp366 A G 13: 99,234,260 H496R probably damaging Het
Zfp467 A T 6: 48,438,755 V321E probably damaging Het
Other mutations in Itsn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Itsn1 APN 16 91806201 unclassified probably benign
IGL01799:Itsn1 APN 16 91848882 missense probably damaging 1.00
IGL02328:Itsn1 APN 16 91815407 missense probably damaging 1.00
IGL02333:Itsn1 APN 16 91820676 intron probably benign
IGL02503:Itsn1 APN 16 91889204 missense possibly damaging 0.62
IGL02628:Itsn1 APN 16 91899623 missense possibly damaging 0.79
IGL02666:Itsn1 APN 16 91820718 intron probably benign
IGL03007:Itsn1 APN 16 91784162 splice site probably benign
IGL03223:Itsn1 APN 16 91905306 missense probably benign 0.00
raphael UTSW 16 91820796 intron probably benign
weevil UTSW 16 91818552 intron probably benign
R0234:Itsn1 UTSW 16 91828280 nonsense probably null
R0255:Itsn1 UTSW 16 91806090 unclassified probably benign
R0432:Itsn1 UTSW 16 91815520 missense probably damaging 1.00
R0455:Itsn1 UTSW 16 91868148 intron probably benign
R0471:Itsn1 UTSW 16 91899589 missense probably damaging 1.00
R0558:Itsn1 UTSW 16 91899623 missense possibly damaging 0.79
R0563:Itsn1 UTSW 16 91820796 intron probably benign
R1657:Itsn1 UTSW 16 91909223 missense probably damaging 1.00
R1671:Itsn1 UTSW 16 91812150 missense probably damaging 1.00
R1742:Itsn1 UTSW 16 91816959 critical splice donor site probably null
R1859:Itsn1 UTSW 16 91889154 intron probably benign
R1898:Itsn1 UTSW 16 91899580 missense probably damaging 1.00
R2016:Itsn1 UTSW 16 91905501 critical splice donor site probably null
R2221:Itsn1 UTSW 16 91853768 intron probably benign
R2244:Itsn1 UTSW 16 91853771 missense probably null
R3160:Itsn1 UTSW 16 91853044 nonsense probably null
R3162:Itsn1 UTSW 16 91853044 nonsense probably null
R3814:Itsn1 UTSW 16 91852921 missense possibly damaging 0.96
R4162:Itsn1 UTSW 16 91852902 missense probably benign 0.00
R4254:Itsn1 UTSW 16 91818552 intron probably benign
R4319:Itsn1 UTSW 16 91818552 intron probably benign
R4321:Itsn1 UTSW 16 91818552 intron probably benign
R4323:Itsn1 UTSW 16 91818552 intron probably benign
R4326:Itsn1 UTSW 16 91853855 intron probably benign
R4515:Itsn1 UTSW 16 91899649 missense probably damaging 0.99
R4584:Itsn1 UTSW 16 91820583 intron probably benign
R4600:Itsn1 UTSW 16 91899587 missense probably damaging 1.00
R4649:Itsn1 UTSW 16 91841588 missense probably damaging 1.00
R4834:Itsn1 UTSW 16 91906789 nonsense probably null
R4868:Itsn1 UTSW 16 91785317 missense probably damaging 0.98
R5036:Itsn1 UTSW 16 91782235 splice site probably benign
R5122:Itsn1 UTSW 16 91893844 intron probably benign
R5161:Itsn1 UTSW 16 91908838 missense possibly damaging 0.95
R5437:Itsn1 UTSW 16 91818591 intron probably benign
R5538:Itsn1 UTSW 16 91784102 missense probably damaging 1.00
R5683:Itsn1 UTSW 16 91905380 missense probably benign 0.00
R5697:Itsn1 UTSW 16 91801589 missense possibly damaging 0.56
R5749:Itsn1 UTSW 16 91906855 missense probably damaging 0.99
R6083:Itsn1 UTSW 16 91853011 missense probably benign 0.01
R6148:Itsn1 UTSW 16 91816852 missense probably damaging 1.00
R6291:Itsn1 UTSW 16 91868096 intron probably benign
R6524:Itsn1 UTSW 16 91911995 missense probably damaging 0.96
R7175:Itsn1 UTSW 16 91868050 missense unknown
R7261:Itsn1 UTSW 16 91905306 missense probably benign 0.00
R7320:Itsn1 UTSW 16 91839699 missense unknown
R7366:Itsn1 UTSW 16 91908450 missense unknown
R7462:Itsn1 UTSW 16 91853185 missense possibly damaging 0.53
R7665:Itsn1 UTSW 16 91841603 missense unknown
R7720:Itsn1 UTSW 16 91868083 missense unknown
R7856:Itsn1 UTSW 16 91908487 critical splice donor site probably null
R7864:Itsn1 UTSW 16 91801566 missense possibly damaging 0.47
R7896:Itsn1 UTSW 16 91818558 missense unknown
R7897:Itsn1 UTSW 16 91818558 missense unknown
R7939:Itsn1 UTSW 16 91908487 critical splice donor site probably null
R7947:Itsn1 UTSW 16 91801566 missense possibly damaging 0.47
R7979:Itsn1 UTSW 16 91818558 missense unknown
R7980:Itsn1 UTSW 16 91818558 missense unknown
Predicted Primers PCR Primer
(F):5'- ATCCCGAATGCTGGAAGAGGTGAC -3'
(R):5'- ACAGGCTACCTTACAGACCTCAGAG -3'

Sequencing Primer
(F):5'- ctcccctcctccctccc -3'
(R):5'- TTACAGACCTCAGAGAAAGCAAG -3'
Posted On2013-07-11