Incidental Mutation 'R7650:Adam33'
ID590731
Institutional Source Beutler Lab
Gene Symbol Adam33
Ensembl Gene ENSMUSG00000027318
Gene Namea disintegrin and metallopeptidase domain 33
Synonyms
MMRRC Submission
Accession Numbers

Genbank: NM_033615, NM_001163529; MGI: 1341813

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7650 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location131050591-131063814 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 131061147 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 59 (E59G)
Ref Sequence ENSEMBL: ENSMUSP00000105861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052104] [ENSMUST00000110232] [ENSMUST00000183552]
Predicted Effect probably damaging
Transcript: ENSMUST00000052104
AA Change: E59G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000052486
Gene: ENSMUSG00000027318
AA Change: E59G

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Pep_M12B_propep 38 168 1.9e-28 PFAM
Pfam:Reprolysin_5 209 390 6.9e-21 PFAM
Pfam:Reprolysin_4 209 401 3.5e-9 PFAM
Pfam:Reprolysin 211 410 1.9e-60 PFAM
Pfam:Reprolysin_2 232 400 3e-14 PFAM
Pfam:Reprolysin_3 235 357 1.2e-16 PFAM
DISIN 427 502 8.4e-42 SMART
ACR 503 647 6.8e-51 SMART
transmembrane domain 677 699 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110232
AA Change: E59G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105861
Gene: ENSMUSG00000027318
AA Change: E59G

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:Pep_M12B_propep 36 168 1.3e-24 PFAM
Pfam:Reprolysin_5 209 390 8.5e-23 PFAM
Pfam:Reprolysin_4 209 401 4.2e-11 PFAM
Pfam:Reprolysin 211 410 4e-63 PFAM
Pfam:Reprolysin_2 231 400 7.3e-17 PFAM
Pfam:Reprolysin_3 235 357 2.2e-20 PFAM
DISIN 427 502 1.66e-39 SMART
ACR 503 646 7.59e-54 SMART
EGF 653 682 1.53e-1 SMART
transmembrane domain 703 725 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135149
SMART Domains Protein: ENSMUSP00000122608
Gene: ENSMUSG00000027318

DomainStartEndE-ValueType
Pfam:Reprolysin_5 68 249 1.8e-23 PFAM
Pfam:Reprolysin_4 68 260 8.6e-12 PFAM
Pfam:Reprolysin 70 269 8.3e-64 PFAM
Pfam:Reprolysin_2 90 259 1.5e-17 PFAM
Pfam:Reprolysin_3 94 216 5.1e-21 PFAM
DISIN 286 361 1.66e-39 SMART
ACR 362 505 8.02e-44 SMART
Predicted Effect unknown
Transcript: ENSMUST00000147333
AA Change: E58G
SMART Domains Protein: ENSMUSP00000117097
Gene: ENSMUSG00000027318
AA Change: E58G

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 74 92 N/A INTRINSIC
low complexity region 138 150 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183552
AA Change: E59G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139344
Gene: ENSMUSG00000027318
AA Change: E59G

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:Pep_M12B_propep 38 168 2.4e-30 PFAM
Pfam:Reprolysin_5 209 390 8.2e-23 PFAM
Pfam:Reprolysin_4 209 401 4.2e-11 PFAM
Pfam:Reprolysin 211 410 2.4e-62 PFAM
Pfam:Reprolysin_2 232 400 2.8e-16 PFAM
Pfam:Reprolysin_3 235 357 1.5e-18 PFAM
DISIN 427 502 1.66e-39 SMART
ACR 503 646 7.59e-54 SMART
EGF 653 682 1.53e-1 SMART
transmembrane domain 703 725 N/A INTRINSIC
Meta Mutation Damage Score 0.2127 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. This gene is widely expressed, most highly in the adult brain, heart, kidney, lung and testis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional metalloprotease enzyme. Alternative splicing results in multiple transcript variants encoding different isoforms, some of which may undergo similar processing. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for a targeted gene deletion are viable, fertile, developmentally normal and display normal allergen-induced airway hyperreactivity, IgE production, mucus metaplasia, and airway inflammation in an OVA-induced model of allergic asthma. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(2) Targeted, other(4)

Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002J24Rik G A 7: 30,699,789 V3I probably benign Het
Akap13 T A 7: 75,643,454 V45E probably benign Het
Ap1s1 A G 5: 137,045,533 S28P probably benign Het
Btnl2 T C 17: 34,358,129 L86P probably damaging Het
Carm1 G A 9: 21,580,372 V246I probably benign Het
Cdk5rap1 C T 2: 154,354,116 D283N probably benign Het
Cfap58 C A 19: 47,986,528 N709K possibly damaging Het
Col24a1 A G 3: 145,314,453 D195G probably benign Het
Dcaf1 A G 9: 106,838,344 D220G probably benign Het
Ddias C T 7: 92,858,935 G591R probably benign Het
Defb22 A T 2: 152,486,103 I54K probably benign Het
Dennd4b G A 3: 90,268,749 W202* probably null Het
F2 T C 2: 91,628,396 N523S possibly damaging Het
Fam186a A G 15: 99,939,907 Y2819H unknown Het
Fanca A T 8: 123,268,564 probably null Het
Fezf2 T C 14: 12,342,653 H404R probably damaging Het
Fry A G 5: 150,413,418 N1418S probably damaging Het
Gak A G 5: 108,584,295 S776P probably benign Het
Gbf1 A G 19: 46,272,539 H1181R probably damaging Het
Gdf9 G A 11: 53,437,098 E294K probably benign Het
Gje1 G A 10: 14,716,424 R205* probably null Het
Gm12569 G A 11: 51,234,786 E179K possibly damaging Het
Gm8206 T C 14: 6,055,211 probably null Het
Gpr162 T A 6: 124,861,843 probably benign Het
Gxylt1 C T 15: 93,245,658 R363H probably benign Het
Hnrnph1 A T 11: 50,383,899 M396L probably benign Het
Ice1 A G 13: 70,589,797 V2177A possibly damaging Het
Ice1 T A 13: 70,605,483 Q828L probably damaging Het
Il10 A T 1: 131,021,455 T118S probably benign Het
Itpr2 C T 6: 146,233,994 R1813Q probably benign Het
Kbtbd12 T A 6: 88,618,548 Q100L probably damaging Het
Kin A G 2: 10,092,168 D276G possibly damaging Het
Klhl1 T C 14: 96,346,943 T284A probably damaging Het
Kmt2d C T 15: 98,850,870 A2858T unknown Het
Krt8 G A 15: 102,004,163 T26M probably benign Het
Lama3 T A 18: 12,537,838 M827K probably benign Het
Lingo3 T C 10: 80,835,763 N111S probably damaging Het
Megf10 GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA GGCAGCAACAGCACCAGCAGCA 18: 57,293,999 probably benign Het
Metap1 A G 3: 138,466,367 V263A probably damaging Het
Muc5ac A G 7: 141,809,422 T2157A unknown Het
Myo1d G T 11: 80,601,684 H748Q probably benign Het
Nfkbiz A T 16: 55,817,839 N419K probably benign Het
Nol10 T C 12: 17,362,682 probably null Het
Nrcam T C 12: 44,547,322 L284P probably damaging Het
Nrp1 T A 8: 128,498,014 W753R possibly damaging Het
Obscn A G 11: 59,060,994 S3978P probably benign Het
Olfr181 T A 16: 58,926,053 R173* probably null Het
Olfr968 A T 9: 39,771,873 F309Y probably benign Het
Opa3 C A 7: 19,244,971 N120K probably benign Het
Pabpc1l T C 2: 164,049,590 L576S probably benign Het
Panx3 A G 9: 37,661,405 L283S probably damaging Het
Pcdhb4 T A 18: 37,309,614 V659E probably damaging Het
Pde4dip A T 3: 97,699,107 probably null Het
Pkd1l3 T C 8: 109,672,585 V2200A probably benign Het
Pkp3 G A 7: 141,082,370 M112I probably benign Het
Prex2 T C 1: 11,149,854 I683T possibly damaging Het
Psg22 C A 7: 18,726,759 Q438K possibly damaging Het
Ptgir T C 7: 16,906,951 V56A possibly damaging Het
Pus7 G T 5: 23,760,246 T304K probably damaging Het
Rab38 T C 7: 88,430,429 Y10H possibly damaging Het
Ros1 C T 10: 52,046,209 G2277D probably benign Het
Rpain A T 11: 70,970,445 probably benign Het
Shh C A 5: 28,458,306 S288I probably benign Het
Slc26a5 C T 5: 21,834,330 V259M possibly damaging Het
Slc4a7 G A 14: 14,773,348 E773K probably benign Het
Slit1 T A 19: 41,629,924 N771I probably damaging Het
Stim1 T A 7: 102,428,827 S179T Het
Syk A G 13: 52,611,095 D86G probably benign Het
Tmem132b T G 5: 125,787,010 S727A probably benign Het
Trim42 T A 9: 97,363,148 Y533F probably benign Het
Trpm6 A T 19: 18,876,013 D1799V possibly damaging Het
Ttc26 T A 6: 38,395,040 N188K probably benign Het
Ube4a A T 9: 44,933,436 I839N probably damaging Het
Ugt2b36 A G 5: 87,080,972 I404T probably damaging Het
Ushbp1 T A 8: 71,390,924 Q290L possibly damaging Het
Vcl T A 14: 20,995,046 I273K probably damaging Het
Vmn2r73 T A 7: 85,871,939 I274L probably benign Het
Zc3h7b A G 15: 81,793,650 D945G possibly damaging Het
Zfp454 A G 11: 50,883,753 L31P probably damaging Het
Zfp536 C A 7: 37,569,692 V100L probably damaging Het
Zfp942 A T 17: 21,928,837 S270R probably benign Het
Other mutations in Adam33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Adam33 APN 2 131054263 splice site probably benign
IGL01586:Adam33 APN 2 131054050 missense probably damaging 1.00
IGL02156:Adam33 APN 2 131053158 splice site probably benign
IGL02498:Adam33 APN 2 131053237 missense probably damaging 1.00
3-1:Adam33 UTSW 2 131054121 splice site probably null
R0012:Adam33 UTSW 2 131052920 missense probably damaging 1.00
R0471:Adam33 UTSW 2 131054479 missense probably damaging 0.99
R1401:Adam33 UTSW 2 131051471 unclassified probably benign
R2071:Adam33 UTSW 2 131055346 missense probably benign 0.01
R2095:Adam33 UTSW 2 131053709 missense probably damaging 1.00
R2383:Adam33 UTSW 2 131051362 missense probably benign 0.01
R4077:Adam33 UTSW 2 131063524 utr 5 prime probably benign
R4403:Adam33 UTSW 2 131053270 missense probably benign 0.03
R4821:Adam33 UTSW 2 131061195 missense probably benign 0.03
R5110:Adam33 UTSW 2 131053770 missense probably damaging 1.00
R5150:Adam33 UTSW 2 131053197 intron probably benign
R5364:Adam33 UTSW 2 131054472 critical splice donor site probably null
R5632:Adam33 UTSW 2 131053442 missense probably damaging 1.00
R5818:Adam33 UTSW 2 131054358 missense possibly damaging 0.51
R6226:Adam33 UTSW 2 131055610 missense probably damaging 1.00
R6478:Adam33 UTSW 2 131051346 missense probably benign 0.01
R6755:Adam33 UTSW 2 131053149 missense probably damaging 1.00
R7230:Adam33 UTSW 2 131053563 missense probably damaging 1.00
R7322:Adam33 UTSW 2 131053694 missense probably damaging 1.00
R7395:Adam33 UTSW 2 131061169 missense probably benign 0.00
R7783:Adam33 UTSW 2 131058337 missense unknown
R7809:Adam33 UTSW 2 131051346 missense probably benign
R7932:Adam33 UTSW 2 131063697 unclassified probably benign
R8210:Adam33 UTSW 2 131056330 missense probably benign
Z1177:Adam33 UTSW 2 131058662 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AGCCTCACGCCATCTAGATG -3'
(R):5'- CCGCTTCAAATTCCCCAATGG -3'

Sequencing Primer
(F):5'- ACGCCATCTAGATGTCTCTTTG -3'
(R):5'- ATCCTGGAAGTGCTACACATG -3'
Posted On2019-10-24