Incidental Mutation 'R7650:Col24a1'
ID 590737
Institutional Source Beutler Lab
Gene Symbol Col24a1
Ensembl Gene ENSMUSG00000028197
Gene Name collagen, type XXIV, alpha 1
Synonyms 5430404K19Rik
MMRRC Submission 045727-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7650 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 144998233-145257766 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 145020214 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 195 (D195G)
Ref Sequence ENSEMBL: ENSMUSP00000029848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029848] [ENSMUST00000139001]
AlphaFold Q30D77
Predicted Effect probably benign
Transcript: ENSMUST00000029848
AA Change: D195G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000029848
Gene: ENSMUSG00000028197
AA Change: D195G

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
TSPN 41 230 2.7e-3 SMART
LamG 106 229 8.07e-2 SMART
Pfam:Collagen 506 565 9.6e-10 PFAM
Pfam:Collagen 561 623 3.4e-10 PFAM
Pfam:Collagen 604 678 2.3e-9 PFAM
low complexity region 682 724 N/A INTRINSIC
Pfam:Collagen 772 837 1.3e-10 PFAM
Pfam:Collagen 865 938 6e-9 PFAM
Pfam:Collagen 967 1042 3.1e-8 PFAM
low complexity region 1056 1075 N/A INTRINSIC
Pfam:Collagen 1107 1180 8e-9 PFAM
Pfam:Collagen 1159 1218 4.2e-10 PFAM
Pfam:Collagen 1218 1279 1.8e-10 PFAM
Pfam:Collagen 1270 1334 3.1e-9 PFAM
Pfam:Collagen 1378 1443 1.3e-9 PFAM
Pfam:Collagen 1439 1500 1.8e-9 PFAM
COLFI 1533 1733 9.34e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139001
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: This gene encodes the alpha-1 subunit of type XXIV collagen, one of the low abundance fibril-forming collagens found in cartilage. The encoded protein has structural features of invertebrate fibrillar collagens and is expressed predominantly in bone tissue. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002J24Rik G A 7: 30,399,214 (GRCm39) V3I probably benign Het
Adam33 T C 2: 130,903,067 (GRCm39) E59G probably damaging Het
Akap13 T A 7: 75,293,202 (GRCm39) V45E probably benign Het
Ap1s1 A G 5: 137,074,387 (GRCm39) S28P probably benign Het
Btnl2 T C 17: 34,577,103 (GRCm39) L86P probably damaging Het
Carm1 G A 9: 21,491,668 (GRCm39) V246I probably benign Het
Cdk5rap1 C T 2: 154,196,036 (GRCm39) D283N probably benign Het
Cfap58 C A 19: 47,974,967 (GRCm39) N709K possibly damaging Het
Dcaf1 A G 9: 106,715,543 (GRCm39) D220G probably benign Het
Ddias C T 7: 92,508,143 (GRCm39) G591R probably benign Het
Defb22 A T 2: 152,328,023 (GRCm39) I54K probably benign Het
Dennd4b G A 3: 90,176,056 (GRCm39) W202* probably null Het
F2 T C 2: 91,458,741 (GRCm39) N523S possibly damaging Het
Fam186a A G 15: 99,837,788 (GRCm39) Y2819H unknown Het
Fanca A T 8: 123,995,303 (GRCm39) probably null Het
Fezf2 T C 14: 12,342,653 (GRCm38) H404R probably damaging Het
Fry A G 5: 150,336,883 (GRCm39) N1418S probably damaging Het
Gak A G 5: 108,732,161 (GRCm39) S776P probably benign Het
Gbf1 A G 19: 46,260,978 (GRCm39) H1181R probably damaging Het
Gdf9 G A 11: 53,327,925 (GRCm39) E294K probably benign Het
Gje1 G A 10: 14,592,168 (GRCm39) R205* probably null Het
Gm8206 T C 14: 6,055,211 (GRCm38) probably null Het
Gpr162 T A 6: 124,838,806 (GRCm39) probably benign Het
Gxylt1 C T 15: 93,143,539 (GRCm39) R363H probably benign Het
Hnrnph1 A T 11: 50,274,726 (GRCm39) M396L probably benign Het
Ice1 A G 13: 70,737,916 (GRCm39) V2177A possibly damaging Het
Ice1 T A 13: 70,753,602 (GRCm39) Q828L probably damaging Het
Ift56 T A 6: 38,371,975 (GRCm39) N188K probably benign Het
Il10 A T 1: 130,949,192 (GRCm39) T118S probably benign Het
Itpr2 C T 6: 146,135,492 (GRCm39) R1813Q probably benign Het
Kbtbd12 T A 6: 88,595,530 (GRCm39) Q100L probably damaging Het
Kin A G 2: 10,096,979 (GRCm39) D276G possibly damaging Het
Klhl1 T C 14: 96,584,379 (GRCm39) T284A probably damaging Het
Kmt2d C T 15: 98,748,751 (GRCm39) A2858T unknown Het
Krt8 G A 15: 101,912,598 (GRCm39) T26M probably benign Het
Lama3 T A 18: 12,670,895 (GRCm39) M827K probably benign Het
Lingo3 T C 10: 80,671,597 (GRCm39) N111S probably damaging Het
Megf10 GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA GGCAGCAACAGCACCAGCAGCA 18: 57,427,071 (GRCm39) probably benign Het
Metap1 A G 3: 138,172,128 (GRCm39) V263A probably damaging Het
Msantd5 G A 11: 51,125,613 (GRCm39) E179K possibly damaging Het
Muc5ac A G 7: 141,363,159 (GRCm39) T2157A unknown Het
Myo1d G T 11: 80,492,510 (GRCm39) H748Q probably benign Het
Nfkbiz A T 16: 55,638,202 (GRCm39) N419K probably benign Het
Nol10 T C 12: 17,412,683 (GRCm39) probably null Het
Nrcam T C 12: 44,594,105 (GRCm39) L284P probably damaging Het
Nrp1 T A 8: 129,224,495 (GRCm39) W753R possibly damaging Het
Obscn A G 11: 58,951,820 (GRCm39) S3978P probably benign Het
Opa3 C A 7: 18,978,896 (GRCm39) N120K probably benign Het
Or5k17 T A 16: 58,746,416 (GRCm39) R173* probably null Het
Or8g53 A T 9: 39,683,169 (GRCm39) F309Y probably benign Het
Pabpc1l T C 2: 163,891,510 (GRCm39) L576S probably benign Het
Panx3 A G 9: 37,572,701 (GRCm39) L283S probably damaging Het
Pcdhb4 T A 18: 37,442,667 (GRCm39) V659E probably damaging Het
Pde4dip A T 3: 97,606,423 (GRCm39) probably null Het
Pkd1l3 T C 8: 110,399,217 (GRCm39) V2200A probably benign Het
Pkp3 G A 7: 140,662,283 (GRCm39) M112I probably benign Het
Prex2 T C 1: 11,220,078 (GRCm39) I683T possibly damaging Het
Psg22 C A 7: 18,460,684 (GRCm39) Q438K possibly damaging Het
Ptgir T C 7: 16,640,876 (GRCm39) V56A possibly damaging Het
Pus7 G T 5: 23,965,244 (GRCm39) T304K probably damaging Het
Rab38 T C 7: 88,079,637 (GRCm39) Y10H possibly damaging Het
Ros1 C T 10: 51,922,305 (GRCm39) G2277D probably benign Het
Rpain A T 11: 70,861,271 (GRCm39) probably benign Het
Shh C A 5: 28,663,304 (GRCm39) S288I probably benign Het
Slc26a5 C T 5: 22,039,328 (GRCm39) V259M possibly damaging Het
Slc4a7 G A 14: 14,773,348 (GRCm38) E773K probably benign Het
Slit1 T A 19: 41,618,363 (GRCm39) N771I probably damaging Het
Stim1 T A 7: 102,078,034 (GRCm39) S179T Het
Syk A G 13: 52,765,131 (GRCm39) D86G probably benign Het
Tmem132b T G 5: 125,864,074 (GRCm39) S727A probably benign Het
Trim42 T A 9: 97,245,201 (GRCm39) Y533F probably benign Het
Trpm6 A T 19: 18,853,377 (GRCm39) D1799V possibly damaging Het
Ube4a A T 9: 44,844,734 (GRCm39) I839N probably damaging Het
Ugt2b36 A G 5: 87,228,831 (GRCm39) I404T probably damaging Het
Ushbp1 T A 8: 71,843,568 (GRCm39) Q290L possibly damaging Het
Vcl T A 14: 21,045,114 (GRCm39) I273K probably damaging Het
Vmn2r73 T A 7: 85,521,147 (GRCm39) I274L probably benign Het
Zc3h7b A G 15: 81,677,851 (GRCm39) D945G possibly damaging Het
Zfp454 A G 11: 50,774,580 (GRCm39) L31P probably damaging Het
Zfp536 C A 7: 37,269,117 (GRCm39) V100L probably damaging Het
Zfp942 A T 17: 22,147,818 (GRCm39) S270R probably benign Het
Other mutations in Col24a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Col24a1 APN 3 145,068,064 (GRCm39) missense probably damaging 1.00
IGL00931:Col24a1 APN 3 145,167,225 (GRCm39) missense probably benign 0.00
IGL01160:Col24a1 APN 3 145,213,468 (GRCm39) missense probably damaging 1.00
IGL01355:Col24a1 APN 3 145,020,637 (GRCm39) missense probably benign 0.07
IGL01409:Col24a1 APN 3 145,244,319 (GRCm39) missense probably benign 0.19
IGL01587:Col24a1 APN 3 145,139,110 (GRCm39) splice site probably null
IGL01666:Col24a1 APN 3 145,050,447 (GRCm39) missense possibly damaging 0.93
IGL01717:Col24a1 APN 3 145,230,018 (GRCm39) splice site probably benign
IGL01721:Col24a1 APN 3 145,244,322 (GRCm39) missense probably benign 0.26
IGL01939:Col24a1 APN 3 145,021,005 (GRCm39) missense probably damaging 1.00
IGL01988:Col24a1 APN 3 145,229,922 (GRCm39) splice site probably null
IGL02002:Col24a1 APN 3 145,062,699 (GRCm39) missense possibly damaging 0.81
IGL02172:Col24a1 APN 3 145,020,723 (GRCm39) missense probably benign 0.34
IGL02552:Col24a1 APN 3 145,179,962 (GRCm39) missense possibly damaging 0.88
IGL02559:Col24a1 APN 3 145,019,934 (GRCm39) missense probably benign
IGL02582:Col24a1 APN 3 145,020,247 (GRCm39) missense probably damaging 1.00
IGL02652:Col24a1 APN 3 145,198,056 (GRCm39) nonsense probably null
IGL02942:Col24a1 APN 3 145,247,420 (GRCm39) missense probably damaging 1.00
IGL03032:Col24a1 APN 3 145,244,458 (GRCm39) critical splice donor site probably null
IGL03108:Col24a1 APN 3 145,029,162 (GRCm39) missense probably damaging 1.00
IGL03310:Col24a1 APN 3 145,019,744 (GRCm39) splice site probably benign
IGL03405:Col24a1 APN 3 145,020,918 (GRCm39) missense possibly damaging 0.73
R0066:Col24a1 UTSW 3 145,250,899 (GRCm39) missense probably damaging 1.00
R0066:Col24a1 UTSW 3 145,250,899 (GRCm39) missense probably damaging 1.00
R0379:Col24a1 UTSW 3 145,229,897 (GRCm39) missense possibly damaging 0.94
R0502:Col24a1 UTSW 3 145,251,071 (GRCm39) splice site probably benign
R0556:Col24a1 UTSW 3 145,020,489 (GRCm39) missense possibly damaging 0.53
R0587:Col24a1 UTSW 3 144,998,906 (GRCm39) missense possibly damaging 0.50
R0617:Col24a1 UTSW 3 145,019,881 (GRCm39) missense probably damaging 1.00
R0831:Col24a1 UTSW 3 145,034,520 (GRCm39) missense probably damaging 1.00
R1455:Col24a1 UTSW 3 145,166,593 (GRCm39) missense probably damaging 1.00
R1664:Col24a1 UTSW 3 145,095,355 (GRCm39) critical splice donor site probably null
R1713:Col24a1 UTSW 3 145,072,624 (GRCm39) nonsense probably null
R1854:Col24a1 UTSW 3 145,164,895 (GRCm39) missense probably damaging 1.00
R1855:Col24a1 UTSW 3 145,164,895 (GRCm39) missense probably damaging 1.00
R1861:Col24a1 UTSW 3 145,243,022 (GRCm39) critical splice donor site probably null
R1969:Col24a1 UTSW 3 145,020,691 (GRCm39) missense probably benign 0.03
R2216:Col24a1 UTSW 3 145,020,742 (GRCm39) missense probably benign 0.34
R2290:Col24a1 UTSW 3 145,218,950 (GRCm39) missense probably damaging 1.00
R3702:Col24a1 UTSW 3 145,043,621 (GRCm39) missense probably benign 0.01
R3772:Col24a1 UTSW 3 145,251,041 (GRCm39) missense probably damaging 1.00
R4086:Col24a1 UTSW 3 145,167,192 (GRCm39) missense probably damaging 1.00
R4236:Col24a1 UTSW 3 145,230,037 (GRCm39) nonsense probably null
R4433:Col24a1 UTSW 3 145,020,144 (GRCm39) missense possibly damaging 0.95
R4688:Col24a1 UTSW 3 145,020,144 (GRCm39) missense probably benign 0.00
R4972:Col24a1 UTSW 3 145,215,439 (GRCm39) missense probably benign 0.42
R5157:Col24a1 UTSW 3 145,051,712 (GRCm39) nonsense probably null
R5216:Col24a1 UTSW 3 145,021,071 (GRCm39) missense possibly damaging 0.85
R5274:Col24a1 UTSW 3 145,190,433 (GRCm39) missense probably benign 0.03
R5334:Col24a1 UTSW 3 145,167,280 (GRCm39) missense possibly damaging 0.91
R5416:Col24a1 UTSW 3 145,020,786 (GRCm39) nonsense probably null
R5473:Col24a1 UTSW 3 145,243,016 (GRCm39) missense probably benign 0.41
R5538:Col24a1 UTSW 3 144,998,882 (GRCm39) missense probably damaging 0.99
R5561:Col24a1 UTSW 3 145,004,588 (GRCm39) missense probably benign 0.26
R5648:Col24a1 UTSW 3 145,064,321 (GRCm39) missense probably benign 0.00
R5920:Col24a1 UTSW 3 145,133,985 (GRCm39) missense probably damaging 1.00
R6111:Col24a1 UTSW 3 145,019,815 (GRCm39) missense probably damaging 0.99
R6151:Col24a1 UTSW 3 145,019,815 (GRCm39) missense probably damaging 0.99
R6701:Col24a1 UTSW 3 145,020,141 (GRCm39) missense probably benign 0.00
R6728:Col24a1 UTSW 3 145,020,957 (GRCm39) missense probably benign
R6734:Col24a1 UTSW 3 145,214,429 (GRCm39) missense probably benign 0.06
R6861:Col24a1 UTSW 3 145,166,589 (GRCm39) missense probably damaging 1.00
R6982:Col24a1 UTSW 3 145,020,807 (GRCm39) nonsense probably null
R7001:Col24a1 UTSW 3 145,004,627 (GRCm39) missense probably benign 0.28
R7148:Col24a1 UTSW 3 145,021,060 (GRCm39) missense probably damaging 1.00
R7293:Col24a1 UTSW 3 145,192,059 (GRCm39) nonsense probably null
R7315:Col24a1 UTSW 3 145,137,625 (GRCm39) missense possibly damaging 0.82
R7358:Col24a1 UTSW 3 144,998,926 (GRCm39) critical splice donor site probably null
R7371:Col24a1 UTSW 3 145,049,459 (GRCm39) missense probably benign 0.06
R7383:Col24a1 UTSW 3 145,004,599 (GRCm39) missense probably benign
R7605:Col24a1 UTSW 3 145,244,442 (GRCm39) missense possibly damaging 0.67
R7679:Col24a1 UTSW 3 145,105,110 (GRCm39) missense possibly damaging 0.81
R7701:Col24a1 UTSW 3 145,072,656 (GRCm39) splice site probably null
R7701:Col24a1 UTSW 3 145,020,772 (GRCm39) missense probably benign
R7805:Col24a1 UTSW 3 145,019,901 (GRCm39) missense probably benign 0.02
R7913:Col24a1 UTSW 3 145,137,621 (GRCm39) nonsense probably null
R7921:Col24a1 UTSW 3 145,179,993 (GRCm39) missense probably damaging 1.00
R8056:Col24a1 UTSW 3 145,019,925 (GRCm39) missense possibly damaging 0.73
R8240:Col24a1 UTSW 3 145,213,457 (GRCm39) missense probably benign 0.31
R8294:Col24a1 UTSW 3 145,186,844 (GRCm39) missense probably null 1.00
R8305:Col24a1 UTSW 3 145,179,937 (GRCm39) missense probably benign 0.00
R8430:Col24a1 UTSW 3 145,021,060 (GRCm39) missense probably damaging 1.00
R8708:Col24a1 UTSW 3 145,251,020 (GRCm39) missense probably damaging 0.99
R8880:Col24a1 UTSW 3 145,019,798 (GRCm39) missense probably null
R9056:Col24a1 UTSW 3 145,021,009 (GRCm39) missense probably damaging 0.96
R9461:Col24a1 UTSW 3 145,186,879 (GRCm39) nonsense probably null
R9612:Col24a1 UTSW 3 145,250,960 (GRCm39) missense probably benign 0.32
R9777:Col24a1 UTSW 3 145,021,103 (GRCm39) nonsense probably null
Z1176:Col24a1 UTSW 3 145,048,259 (GRCm39) missense probably damaging 1.00
Z1177:Col24a1 UTSW 3 145,048,260 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCATTCGGAATAACAACAGACTG -3'
(R):5'- ATTCCTGCCGTGTGAGGAAG -3'

Sequencing Primer
(F):5'- CAACAGACTGCAGTTTGGCGTAC -3'
(R):5'- CTGCCGTGTGAGGAAGGTTTC -3'
Posted On 2019-10-24