Mutagenetix > Incidental Mutations

Incidental Mutation 'R7650:Slc26a5'

590738

Institutional Source

Beutler Lab

Gene Symbol

Slc26a5

Ensembl Gene

ENSMUSG00000029015

Gene Name

solute carrier family 26, member 5

Synonyms

Pres, prestin

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7650 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

21810655-21865604 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 21834330 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 259 (V259M)

Ref Sequence

ENSEMBL: ENSMUSP00000030878 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030878] [ENSMUST00000115176] [ENSMUST00000127975] [ENSMUST00000142888]

AlphaFold

Q99NH7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000030878
AA Change: V259M

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000030878
Gene: ENSMUSG00000029015
AA Change: V259M

Domain	Start	End	E-Value	Type
Pfam:Sulfate_transp	80	475	3.3e-109	PFAM
transmembrane domain	476	498	N/A	INTRINSIC
Pfam:STAS	526	709	3.3e-27	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000115176
AA Change: V222M

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000110830
Gene: ENSMUSG00000029015
AA Change: V222M

Domain	Start	End	E-Value	Type
Pfam:Sulfate_tra_GLY	65	106	5.2e-9	PFAM
Pfam:Sulfate_transp	156	434	1.6e-65	PFAM
transmembrane domain	439	461	N/A	INTRINSIC
Pfam:STAS	489	672	1.5e-27	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000127975
AA Change: V259M

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000118029
Gene: ENSMUSG00000029015
AA Change: V259M

Domain	Start	End	E-Value	Type
Pfam:Sulfate_tra_GLY	65	148	4.3e-33	PFAM
Pfam:Sulfate_transp	193	440	8.9e-56	PFAM
transmembrane domain	447	469	N/A	INTRINSIC
Pfam:STAS	494	677	4.1e-27	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000142888
AA Change: V259M

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000118263
Gene: ENSMUSG00000029015
AA Change: V259M

Domain	Start	End	E-Value	Type
Pfam:Sulfate_tra_GLY	65	148	2.1e-33	PFAM
Pfam:Sulfate_transp	193	441	9.6e-49	PFAM

Meta Mutation Damage Score

0.1157

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

100% (80/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLC26A/SulP transporter family. The protein functions as a molecular motor in motile outer hair cells (OHCs) of the cochlea, inducing changes in cell length that act to amplify sound levels. The transmembrane protein is an incomplete anion transporter, and does not allow anions to cross the cell membrane but instead undergoes a conformational change in response to changes in intracellular Cl- levels that results in a change in cell length. The protein functions at microsecond rates, which is several orders of magnitude faster than conventional molecular motor proteins. Mutations in this gene are potential candidates for causing neurosensory deafness. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Nov 2009]
PHENOTYPE: Cochlear sensitivity is decreased in mutant due to a loss of outer hair cell electromotility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2200002J24Rik	G	A	7: 30,699,789	V3I	probably benign	Het
Adam33	T	C	2: 131,061,147	E59G	probably damaging	Het
Akap13	T	A	7: 75,643,454	V45E	probably benign	Het
Ap1s1	A	G	5: 137,045,533	S28P	probably benign	Het
Btnl2	T	C	17: 34,358,129	L86P	probably damaging	Het
Carm1	G	A	9: 21,580,372	V246I	probably benign	Het
Cdk5rap1	C	T	2: 154,354,116	D283N	probably benign	Het
Cfap58	C	A	19: 47,986,528	N709K	possibly damaging	Het
Col24a1	A	G	3: 145,314,453	D195G	probably benign	Het
Dcaf1	A	G	9: 106,838,344	D220G	probably benign	Het
Ddias	C	T	7: 92,858,935	G591R	probably benign	Het
Defb22	A	T	2: 152,486,103	I54K	probably benign	Het
Dennd4b	G	A	3: 90,268,749	W202*	probably null	Het
F2	T	C	2: 91,628,396	N523S	possibly damaging	Het
Fam186a	A	G	15: 99,939,907	Y2819H	unknown	Het
Fanca	A	T	8: 123,268,564		probably null	Het
Fezf2	T	C	14: 12,342,653	H404R	probably damaging	Het
Fry	A	G	5: 150,413,418	N1418S	probably damaging	Het
Gak	A	G	5: 108,584,295	S776P	probably benign	Het
Gbf1	A	G	19: 46,272,539	H1181R	probably damaging	Het
Gdf9	G	A	11: 53,437,098	E294K	probably benign	Het
Gje1	G	A	10: 14,716,424	R205*	probably null	Het
Gm12569	G	A	11: 51,234,786	E179K	possibly damaging	Het
Gm8206	T	C	14: 6,055,211		probably null	Het
Gpr162	T	A	6: 124,861,843		probably benign	Het
Gxylt1	C	T	15: 93,245,658	R363H	probably benign	Het
Hnrnph1	A	T	11: 50,383,899	M396L	probably benign	Het
Ice1	A	G	13: 70,589,797	V2177A	possibly damaging	Het
Ice1	T	A	13: 70,605,483	Q828L	probably damaging	Het
Il10	A	T	1: 131,021,455	T118S	probably benign	Het
Itpr2	C	T	6: 146,233,994	R1813Q	probably benign	Het
Kbtbd12	T	A	6: 88,618,548	Q100L	probably damaging	Het
Kin	A	G	2: 10,092,168	D276G	possibly damaging	Het
Klhl1	T	C	14: 96,346,943	T284A	probably damaging	Het
Kmt2d	C	T	15: 98,850,870	A2858T	unknown	Het
Krt8	G	A	15: 102,004,163	T26M	probably benign	Het
Lama3	T	A	18: 12,537,838	M827K	probably benign	Het
Lingo3	T	C	10: 80,835,763	N111S	probably damaging	Het
Megf10	GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA	GGCAGCAACAGCACCAGCAGCA	18: 57,293,999		probably benign	Het
Metap1	A	G	3: 138,466,367	V263A	probably damaging	Het
Muc5ac	A	G	7: 141,809,422	T2157A	unknown	Het
Myo1d	G	T	11: 80,601,684	H748Q	probably benign	Het
Nfkbiz	A	T	16: 55,817,839	N419K	probably benign	Het
Nol10	T	C	12: 17,362,682		probably null	Het
Nrcam	T	C	12: 44,547,322	L284P	probably damaging	Het
Nrp1	T	A	8: 128,498,014	W753R	possibly damaging	Het
Obscn	A	G	11: 59,060,994	S3978P	probably benign	Het
Olfr181	T	A	16: 58,926,053	R173*	probably null	Het
Olfr968	A	T	9: 39,771,873	F309Y	probably benign	Het
Opa3	C	A	7: 19,244,971	N120K	probably benign	Het
Pabpc1l	T	C	2: 164,049,590	L576S	probably benign	Het
Panx3	A	G	9: 37,661,405	L283S	probably damaging	Het
Pcdhb4	T	A	18: 37,309,614	V659E	probably damaging	Het
Pde4dip	A	T	3: 97,699,107		probably null	Het
Pkd1l3	T	C	8: 109,672,585	V2200A	probably benign	Het
Pkp3	G	A	7: 141,082,370	M112I	probably benign	Het
Prex2	T	C	1: 11,149,854	I683T	possibly damaging	Het
Psg22	C	A	7: 18,726,759	Q438K	possibly damaging	Het
Ptgir	T	C	7: 16,906,951	V56A	possibly damaging	Het
Pus7	G	T	5: 23,760,246	T304K	probably damaging	Het
Rab38	T	C	7: 88,430,429	Y10H	possibly damaging	Het
Ros1	C	T	10: 52,046,209	G2277D	probably benign	Het
Rpain	A	T	11: 70,970,445		probably benign	Het
Shh	C	A	5: 28,458,306	S288I	probably benign	Het
Slc4a7	G	A	14: 14,773,348	E773K	probably benign	Het
Slit1	T	A	19: 41,629,924	N771I	probably damaging	Het
Stim1	T	A	7: 102,428,827	S179T		Het
Syk	A	G	13: 52,611,095	D86G	probably benign	Het
Tmem132b	T	G	5: 125,787,010	S727A	probably benign	Het
Trim42	T	A	9: 97,363,148	Y533F	probably benign	Het
Trpm6	A	T	19: 18,876,013	D1799V	possibly damaging	Het
Ttc26	T	A	6: 38,395,040	N188K	probably benign	Het
Ube4a	A	T	9: 44,933,436	I839N	probably damaging	Het
Ugt2b36	A	G	5: 87,080,972	I404T	probably damaging	Het
Ushbp1	T	A	8: 71,390,924	Q290L	possibly damaging	Het
Vcl	T	A	14: 20,995,046	I273K	probably damaging	Het
Vmn2r73	T	A	7: 85,871,939	I274L	probably benign	Het
Zc3h7b	A	G	15: 81,793,650	D945G	possibly damaging	Het
Zfp454	A	G	11: 50,883,753	L31P	probably damaging	Het
Zfp536	C	A	7: 37,569,692	V100L	probably damaging	Het
Zfp942	A	T	17: 21,928,837	S270R	probably benign	Het

Other mutations in Slc26a5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01412:Slc26a5	APN	5	21815736	missense	probably damaging	1.00
IGL02486:Slc26a5	APN	5	21846325	missense	probably damaging	1.00
IGL02639:Slc26a5	APN	5	21819767	missense	probably damaging	1.00
IGL02810:Slc26a5	APN	5	21813383	splice site	probably benign
R0002:Slc26a5	UTSW	5	21814983	missense	probably damaging	1.00
R0002:Slc26a5	UTSW	5	21814983	missense	probably damaging	1.00
R0089:Slc26a5	UTSW	5	21811344	splice site	probably null
R0136:Slc26a5	UTSW	5	21834347	missense	probably damaging	1.00
R0212:Slc26a5	UTSW	5	21823549	nonsense	probably null
R0522:Slc26a5	UTSW	5	21846345	missense	probably damaging	0.96
R0557:Slc26a5	UTSW	5	21819764	missense	probably damaging	1.00
R0711:Slc26a5	UTSW	5	21847232	missense	probably damaging	1.00
R0959:Slc26a5	UTSW	5	21816961	missense	probably benign	0.01
R1214:Slc26a5	UTSW	5	21814983	missense	probably damaging	1.00
R1471:Slc26a5	UTSW	5	21816964	missense	probably benign	0.12
R1647:Slc26a5	UTSW	5	21813976	nonsense	probably null
R1648:Slc26a5	UTSW	5	21813976	nonsense	probably null
R1861:Slc26a5	UTSW	5	21816958	missense	possibly damaging	0.93
R1875:Slc26a5	UTSW	5	21815727	missense	probably benign	0.03
R2106:Slc26a5	UTSW	5	21823544	missense	probably damaging	1.00
R2169:Slc26a5	UTSW	5	21813865	missense	probably damaging	1.00
R2219:Slc26a5	UTSW	5	21823478	missense	probably damaging	1.00
R2276:Slc26a5	UTSW	5	21823547	missense	probably benign	0.39
R2281:Slc26a5	UTSW	5	21831510	missense	possibly damaging	0.94
R2325:Slc26a5	UTSW	5	21819694	missense	probably damaging	1.00
R4031:Slc26a5	UTSW	5	21847191	missense	probably damaging	1.00
R4793:Slc26a5	UTSW	5	21837994	missense	probably damaging	1.00
R4941:Slc26a5	UTSW	5	21820386	missense	probably damaging	1.00
R5122:Slc26a5	UTSW	5	21847196	missense	probably damaging	1.00
R5274:Slc26a5	UTSW	5	21813901	missense	possibly damaging	0.74
R5312:Slc26a5	UTSW	5	21847260	missense	probably damaging	0.99
R5628:Slc26a5	UTSW	5	21816976	missense	probably benign	0.20
R5806:Slc26a5	UTSW	5	21823563	missense	probably damaging	1.00
R6227:Slc26a5	UTSW	5	21821097	missense	probably damaging	1.00
R6525:Slc26a5	UTSW	5	21820350	missense	possibly damaging	0.77
R6609:Slc26a5	UTSW	5	21819719	missense	possibly damaging	0.93
R6885:Slc26a5	UTSW	5	21834344	missense	probably damaging	1.00
R6974:Slc26a5	UTSW	5	21840572	missense	probably damaging	1.00
R7001:Slc26a5	UTSW	5	21811336	missense	probably damaging	1.00
R7027:Slc26a5	UTSW	5	21816974	missense	possibly damaging	0.60
R7174:Slc26a5	UTSW	5	21813894	missense	probably damaging	1.00
R7184:Slc26a5	UTSW	5	21837246	nonsense	probably null
R8431:Slc26a5	UTSW	5	21813906	missense	probably damaging	1.00
R8812:Slc26a5	UTSW	5	21813882	missense	probably damaging	1.00
R9184:Slc26a5	UTSW	5	21813882	missense	probably damaging	1.00
R9215:Slc26a5	UTSW	5	21837287	missense	possibly damaging	0.93
R9281:Slc26a5	UTSW	5	21814053	missense	probably benign	0.39
R9324:Slc26a5	UTSW	5	21813336	missense	possibly damaging	0.73

Predicted Primers

PCR Primer
(F):5'- ATCAGGTGTATGCAGTCCCAG -3'
(R):5'- GTCCATAACAAAGCATATCTCCTTG -3'

Sequencing Primer
(F):5'- TATGCAGTCCCAGGGCTGAAC -3'
(R):5'- CTGGAATCTATTTCAGCAACGGAGAC -3'

Posted On

2019-10-24