Incidental Mutation 'R7650:Shh'
ID590740
Institutional Source Beutler Lab
Gene Symbol Shh
Ensembl Gene ENSMUSG00000002633
Gene Namesonic hedgehog
SynonymsHx, Hxl3, Hhg1, M100081
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7650 (G1)
Quality Score125.008
Status Validated
Chromosome5
Chromosomal Location28456815-28467256 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 28458306 bp
ZygosityHeterozygous
Amino Acid Change Serine to Isoleucine at position 288 (S288I)
Ref Sequence ENSEMBL: ENSMUSP00000002708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002708]
PDB Structure
A POTENTIAL CATALYTIC SITE WITHIN THE AMINO-TERMINAL SIGNALLING DOMAIN OF SONIC HEDGEHOG [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE COMPLEX BETWEEN HUMAN HEDGEHOG-INTERACTING PROTEIN HIP AND SONIC HEDGEHOG IN THE PRESENCE OF CALCIUM [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE COMPLEX BETWEEN HUMAN HEDGEHOG-INTERACTING PROTEIN HIP AND SONIC HEDGEHOG WITHOUT CALCIUM [X-RAY DIFFRACTION]
Crystal Structure of Sonic Hedgehog Bound to the third FNIII domain of CDO [X-RAY DIFFRACTION]
Crystal Structure of ShhN [X-RAY DIFFRACTION]
Crystal structure of the Sonic Hedgehog-chondroitin-4-sulphate complex [X-RAY DIFFRACTION]
Crystal structure of the Sonic Hedgehog-heparin complex [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000002708
AA Change: S288I

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000002708
Gene: ENSMUSG00000002633
AA Change: S288I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:HH_signal 25 185 5.6e-92 PFAM
HintN 197 305 1.21e-30 SMART
HintC 310 355 4.58e-8 SMART
low complexity region 359 379 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is instrumental in patterning the early embryo. It has been implicated as the key inductive signal in patterning of the ventral neural tube, the anterior-posterior limb axis, and the ventral somites. Of three human proteins showing sequence and functional similarity to the sonic hedgehog protein of Drosophila, this protein is the most similar. The protein is made as a precursor that is autocatalytically cleaved; the N-terminal portion is soluble and contains the signalling activity while the C-terminal portion is involved in precursor processing. More importantly, the C-terminal product covalently attaches a cholesterol moiety to the N-terminal product, restricting the N-terminal product to the cell surface and preventing it from freely diffusing throughout the developing embryo. Defects in this protein or in its signalling pathway are a cause of holoprosencephaly (HPE), a disorder in which the developing forebrain fails to correctly separate into right and left hemispheres. HPE is manifested by facial deformities. It is also thought that mutations in this gene or in its signalling pathway may be responsible for VACTERL syndrome, which is characterized by vertebral defects, anal atresia, tracheoesophageal fistula with esophageal atresia, radial and renal dysplasia, cardiac anomalies, and limb abnormalities. Additionally, mutations in a long range enhancer located approximately 1 megabase upstream of this gene disrupt limb patterning and can result in preaxial polydactyly. [provided by RefSeq, Jul 2008]
PHENOTYPE: Heterozygotes exhibit shortening of all digits, holes between the frontal bones, dyssymphyses between cervical vertebrae and bony plates over many ribs. Homozygotes usually die before E12, are short-limbed dwarfs and lack forefeet, hindfeet, eyes, ears, external genitalia and a mouth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002J24Rik G A 7: 30,699,789 V3I probably benign Het
Adam33 T C 2: 131,061,147 E59G probably damaging Het
Akap13 T A 7: 75,643,454 V45E probably benign Het
Ap1s1 A G 5: 137,045,533 S28P probably benign Het
Btnl2 T C 17: 34,358,129 L86P probably damaging Het
Carm1 G A 9: 21,580,372 V246I probably benign Het
Cdk5rap1 C T 2: 154,354,116 D283N probably benign Het
Cfap58 C A 19: 47,986,528 N709K possibly damaging Het
Col24a1 A G 3: 145,314,453 D195G probably benign Het
Dcaf1 A G 9: 106,838,344 D220G probably benign Het
Ddias C T 7: 92,858,935 G591R probably benign Het
Defb22 A T 2: 152,486,103 I54K probably benign Het
Dennd4b G A 3: 90,268,749 W202* probably null Het
F2 T C 2: 91,628,396 N523S possibly damaging Het
Fam186a A G 15: 99,939,907 Y2819H unknown Het
Fanca A T 8: 123,268,564 probably null Het
Fezf2 T C 14: 12,342,653 H404R probably damaging Het
Fry A G 5: 150,413,418 N1418S probably damaging Het
Gak A G 5: 108,584,295 S776P probably benign Het
Gbf1 A G 19: 46,272,539 H1181R probably damaging Het
Gdf9 G A 11: 53,437,098 E294K probably benign Het
Gje1 G A 10: 14,716,424 R205* probably null Het
Gm12569 G A 11: 51,234,786 E179K possibly damaging Het
Gm8206 T C 14: 6,055,211 probably null Het
Gpr162 T A 6: 124,861,843 probably benign Het
Gxylt1 C T 15: 93,245,658 R363H probably benign Het
Hnrnph1 A T 11: 50,383,899 M396L probably benign Het
Ice1 T A 13: 70,605,483 Q828L probably damaging Het
Ice1 A G 13: 70,589,797 V2177A possibly damaging Het
Il10 A T 1: 131,021,455 T118S probably benign Het
Itpr2 C T 6: 146,233,994 R1813Q probably benign Het
Kbtbd12 T A 6: 88,618,548 Q100L probably damaging Het
Kin A G 2: 10,092,168 D276G possibly damaging Het
Klhl1 T C 14: 96,346,943 T284A probably damaging Het
Kmt2d C T 15: 98,850,870 A2858T unknown Het
Krt8 G A 15: 102,004,163 T26M probably benign Het
Lama3 T A 18: 12,537,838 M827K probably benign Het
Lingo3 T C 10: 80,835,763 N111S probably damaging Het
Megf10 GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA GGCAGCAACAGCACCAGCAGCA 18: 57,293,999 probably benign Het
Metap1 A G 3: 138,466,367 V263A probably damaging Het
Muc5ac A G 7: 141,809,422 T2157A unknown Het
Myo1d G T 11: 80,601,684 H748Q probably benign Het
Nfkbiz A T 16: 55,817,839 N419K probably benign Het
Nol10 T C 12: 17,362,682 probably null Het
Nrcam T C 12: 44,547,322 L284P probably damaging Het
Nrp1 T A 8: 128,498,014 W753R possibly damaging Het
Obscn A G 11: 59,060,994 S3978P probably benign Het
Olfr181 T A 16: 58,926,053 R173* probably null Het
Olfr968 A T 9: 39,771,873 F309Y probably benign Het
Opa3 C A 7: 19,244,971 N120K probably benign Het
Pabpc1l T C 2: 164,049,590 L576S probably benign Het
Panx3 A G 9: 37,661,405 L283S probably damaging Het
Pcdhb4 T A 18: 37,309,614 V659E probably damaging Het
Pde4dip A T 3: 97,699,107 probably null Het
Pkd1l3 T C 8: 109,672,585 V2200A probably benign Het
Pkp3 G A 7: 141,082,370 M112I probably benign Het
Prex2 T C 1: 11,149,854 I683T possibly damaging Het
Psg22 C A 7: 18,726,759 Q438K possibly damaging Het
Ptgir T C 7: 16,906,951 V56A possibly damaging Het
Pus7 G T 5: 23,760,246 T304K probably damaging Het
Rab38 T C 7: 88,430,429 Y10H possibly damaging Het
Ros1 C T 10: 52,046,209 G2277D probably benign Het
Rpain A T 11: 70,970,445 probably benign Het
Slc26a5 C T 5: 21,834,330 V259M possibly damaging Het
Slc4a7 G A 14: 14,773,348 E773K probably benign Het
Slit1 T A 19: 41,629,924 N771I probably damaging Het
Stim1 T A 7: 102,428,827 S179T Het
Syk A G 13: 52,611,095 D86G probably benign Het
Tmem132b T G 5: 125,787,010 S727A probably benign Het
Trim42 T A 9: 97,363,148 Y533F probably benign Het
Trpm6 A T 19: 18,876,013 D1799V possibly damaging Het
Ttc26 T A 6: 38,395,040 N188K probably benign Het
Ube4a A T 9: 44,933,436 I839N probably damaging Het
Ugt2b36 A G 5: 87,080,972 I404T probably damaging Het
Ushbp1 T A 8: 71,390,924 Q290L possibly damaging Het
Vcl T A 14: 20,995,046 I273K probably damaging Het
Vmn2r73 T A 7: 85,871,939 I274L probably benign Het
Zc3h7b A G 15: 81,793,650 D945G possibly damaging Het
Zfp454 A G 11: 50,883,753 L31P probably damaging Het
Zfp536 C A 7: 37,569,692 V100L probably damaging Het
Zfp942 A T 17: 21,928,837 S270R probably benign Het
Other mutations in Shh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03066:Shh APN 5 28461371 missense probably damaging 1.00
BB005:Shh UTSW 5 28461406 missense possibly damaging 0.88
BB015:Shh UTSW 5 28461406 missense possibly damaging 0.88
R2484:Shh UTSW 5 28466742 missense probably benign 0.22
R4153:Shh UTSW 5 28457949 missense probably damaging 1.00
R4352:Shh UTSW 5 28458189 missense probably benign
R4668:Shh UTSW 5 28457855 makesense probably null
R5371:Shh UTSW 5 28466690 missense probably damaging 1.00
R5407:Shh UTSW 5 28466580 nonsense probably null
R6035:Shh UTSW 5 28461399 missense probably damaging 1.00
R6035:Shh UTSW 5 28461399 missense probably damaging 1.00
R7762:Shh UTSW 5 28466666 missense probably benign 0.00
R7873:Shh UTSW 5 28458300 missense possibly damaging 0.71
R7928:Shh UTSW 5 28461406 missense possibly damaging 0.88
X0019:Shh UTSW 5 28461540 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGTTGATGAGAATGGTGCC -3'
(R):5'- TCTCTACTCCGCAGAGAACTC -3'

Sequencing Primer
(F):5'- ATGAGAATGGTGCCGTGCG -3'
(R):5'- AAATCCGGCGGCTGTTTC -3'
Posted On2019-10-24