Incidental Mutation 'R7650:Gak'
ID 590742
Institutional Source Beutler Lab
Gene Symbol Gak
Ensembl Gene ENSMUSG00000062234
Gene Name cyclin G associated kinase
Synonyms D130045N16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7650 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 108569411-108629755 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 108584295 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 776 (S776P)
Ref Sequence ENSEMBL: ENSMUSP00000036705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046603] [ENSMUST00000135225] [ENSMUST00000139303] [ENSMUST00000145467] [ENSMUST00000199048]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000046603
AA Change: S776P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000036705
Gene: ENSMUSG00000062234
AA Change: S776P

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
Pfam:Pkinase 40 313 1.6e-49 PFAM
Pfam:Pkinase_Tyr 40 313 3e-30 PFAM
PTEN_C2 568 707 1.43e-44 SMART
low complexity region 819 833 N/A INTRINSIC
low complexity region 932 945 N/A INTRINSIC
low complexity region 1084 1092 N/A INTRINSIC
low complexity region 1094 1110 N/A INTRINSIC
DnaJ 1240 1301 2.3e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135225
SMART Domains Protein: ENSMUSP00000118008
Gene: ENSMUSG00000062234

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
Pfam:Pkinase 40 128 7.9e-11 PFAM
Pfam:Pkinase_Tyr 40 128 1.2e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139303
SMART Domains Protein: ENSMUSP00000116862
Gene: ENSMUSG00000062234

DomainStartEndE-ValueType
PTEN_C2 41 164 4.73e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145467
SMART Domains Protein: ENSMUSP00000118713
Gene: ENSMUSG00000062234

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
Pfam:Pkinase 40 128 7.9e-11 PFAM
Pfam:Pkinase_Tyr 40 128 1.2e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156110
SMART Domains Protein: ENSMUSP00000115184
Gene: ENSMUSG00000062234

DomainStartEndE-ValueType
Pfam:PTEN_C2 4 59 9.5e-14 PFAM
low complexity region 122 136 N/A INTRINSIC
low complexity region 235 248 N/A INTRINSIC
low complexity region 387 395 N/A INTRINSIC
low complexity region 397 413 N/A INTRINSIC
DnaJ 543 604 2.3e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199048
SMART Domains Protein: ENSMUSP00000142931
Gene: ENSMUSG00000062234

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
PDB:4O38|B 23 69 3e-10 PDB
SCOP:d1koba_ 41 69 3e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200204
Meta Mutation Damage Score 0.0716 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In all eukaryotes, the cell cycle is governed by cyclin-dependent protein kinases (CDKs), whose activities are regulated by cyclins and CDK inhibitors in a diverse array of mechanisms that involve the control of phosphorylation and dephosphorylation of Ser, Thr or Tyr residues. Cyclins are molecules that possess a consensus domain called the 'cyclin box.' In mammalian cells, 9 cyclin species have been identified, and they are referred to as cyclins A through I. Cyclin G is a direct transcriptional target of the p53 tumor suppressor gene product and thus functions downstream of p53. GAK is an association partner of cyclin G and CDK5. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a deletion of the kinase domain display neonatal lethality with abnormal lung alveolar morphology and development. Mice homozygous for a knock-out allele exhibit lethality during early development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002J24Rik G A 7: 30,699,789 V3I probably benign Het
Adam33 T C 2: 131,061,147 E59G probably damaging Het
Akap13 T A 7: 75,643,454 V45E probably benign Het
Ap1s1 A G 5: 137,045,533 S28P probably benign Het
Btnl2 T C 17: 34,358,129 L86P probably damaging Het
Carm1 G A 9: 21,580,372 V246I probably benign Het
Cdk5rap1 C T 2: 154,354,116 D283N probably benign Het
Cfap58 C A 19: 47,986,528 N709K possibly damaging Het
Col24a1 A G 3: 145,314,453 D195G probably benign Het
Dcaf1 A G 9: 106,838,344 D220G probably benign Het
Ddias C T 7: 92,858,935 G591R probably benign Het
Defb22 A T 2: 152,486,103 I54K probably benign Het
Dennd4b G A 3: 90,268,749 W202* probably null Het
F2 T C 2: 91,628,396 N523S possibly damaging Het
Fam186a A G 15: 99,939,907 Y2819H unknown Het
Fanca A T 8: 123,268,564 probably null Het
Fezf2 T C 14: 12,342,653 H404R probably damaging Het
Fry A G 5: 150,413,418 N1418S probably damaging Het
Gbf1 A G 19: 46,272,539 H1181R probably damaging Het
Gdf9 G A 11: 53,437,098 E294K probably benign Het
Gje1 G A 10: 14,716,424 R205* probably null Het
Gm12569 G A 11: 51,234,786 E179K possibly damaging Het
Gm8206 T C 14: 6,055,211 probably null Het
Gpr162 T A 6: 124,861,843 probably benign Het
Gxylt1 C T 15: 93,245,658 R363H probably benign Het
Hnrnph1 A T 11: 50,383,899 M396L probably benign Het
Ice1 A G 13: 70,589,797 V2177A possibly damaging Het
Ice1 T A 13: 70,605,483 Q828L probably damaging Het
Il10 A T 1: 131,021,455 T118S probably benign Het
Itpr2 C T 6: 146,233,994 R1813Q probably benign Het
Kbtbd12 T A 6: 88,618,548 Q100L probably damaging Het
Kin A G 2: 10,092,168 D276G possibly damaging Het
Klhl1 T C 14: 96,346,943 T284A probably damaging Het
Kmt2d C T 15: 98,850,870 A2858T unknown Het
Krt8 G A 15: 102,004,163 T26M probably benign Het
Lama3 T A 18: 12,537,838 M827K probably benign Het
Lingo3 T C 10: 80,835,763 N111S probably damaging Het
Megf10 GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA GGCAGCAACAGCACCAGCAGCA 18: 57,293,999 probably benign Het
Metap1 A G 3: 138,466,367 V263A probably damaging Het
Muc5ac A G 7: 141,809,422 T2157A unknown Het
Myo1d G T 11: 80,601,684 H748Q probably benign Het
Nfkbiz A T 16: 55,817,839 N419K probably benign Het
Nol10 T C 12: 17,362,682 probably null Het
Nrcam T C 12: 44,547,322 L284P probably damaging Het
Nrp1 T A 8: 128,498,014 W753R possibly damaging Het
Obscn A G 11: 59,060,994 S3978P probably benign Het
Olfr181 T A 16: 58,926,053 R173* probably null Het
Olfr968 A T 9: 39,771,873 F309Y probably benign Het
Opa3 C A 7: 19,244,971 N120K probably benign Het
Pabpc1l T C 2: 164,049,590 L576S probably benign Het
Panx3 A G 9: 37,661,405 L283S probably damaging Het
Pcdhb4 T A 18: 37,309,614 V659E probably damaging Het
Pde4dip A T 3: 97,699,107 probably null Het
Pkd1l3 T C 8: 109,672,585 V2200A probably benign Het
Pkp3 G A 7: 141,082,370 M112I probably benign Het
Prex2 T C 1: 11,149,854 I683T possibly damaging Het
Psg22 C A 7: 18,726,759 Q438K possibly damaging Het
Ptgir T C 7: 16,906,951 V56A possibly damaging Het
Pus7 G T 5: 23,760,246 T304K probably damaging Het
Rab38 T C 7: 88,430,429 Y10H possibly damaging Het
Ros1 C T 10: 52,046,209 G2277D probably benign Het
Rpain A T 11: 70,970,445 probably benign Het
Shh C A 5: 28,458,306 S288I probably benign Het
Slc26a5 C T 5: 21,834,330 V259M possibly damaging Het
Slc4a7 G A 14: 14,773,348 E773K probably benign Het
Slit1 T A 19: 41,629,924 N771I probably damaging Het
Stim1 T A 7: 102,428,827 S179T Het
Syk A G 13: 52,611,095 D86G probably benign Het
Tmem132b T G 5: 125,787,010 S727A probably benign Het
Trim42 T A 9: 97,363,148 Y533F probably benign Het
Trpm6 A T 19: 18,876,013 D1799V possibly damaging Het
Ttc26 T A 6: 38,395,040 N188K probably benign Het
Ube4a A T 9: 44,933,436 I839N probably damaging Het
Ugt2b36 A G 5: 87,080,972 I404T probably damaging Het
Ushbp1 T A 8: 71,390,924 Q290L possibly damaging Het
Vcl T A 14: 20,995,046 I273K probably damaging Het
Vmn2r73 T A 7: 85,871,939 I274L probably benign Het
Zc3h7b A G 15: 81,793,650 D945G possibly damaging Het
Zfp454 A G 11: 50,883,753 L31P probably damaging Het
Zfp536 C A 7: 37,569,692 V100L probably damaging Het
Zfp942 A T 17: 21,928,837 S270R probably benign Het
Other mutations in Gak
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:Gak APN 5 108613634 makesense probably null
IGL00768:Gak APN 5 108576654 missense probably benign
IGL01128:Gak APN 5 108592370 missense probably damaging 0.97
IGL01557:Gak APN 5 108584337 missense probably damaging 1.00
IGL02559:Gak APN 5 108584232 missense probably null 0.07
PIT4449001:Gak UTSW 5 108580925 missense probably benign 0.00
R0030:Gak UTSW 5 108613547 nonsense probably null
R1403:Gak UTSW 5 108591145 missense probably damaging 1.00
R1403:Gak UTSW 5 108591145 missense probably damaging 1.00
R1530:Gak UTSW 5 108624193 missense probably damaging 0.97
R1646:Gak UTSW 5 108602854 missense probably damaging 1.00
R1699:Gak UTSW 5 108604377 nonsense probably null
R1702:Gak UTSW 5 108606376 splice site probably null
R1732:Gak UTSW 5 108576582 missense probably benign 0.28
R1738:Gak UTSW 5 108616976 missense probably damaging 1.00
R1772:Gak UTSW 5 108606892 missense probably damaging 1.00
R1792:Gak UTSW 5 108585531 nonsense probably null
R2068:Gak UTSW 5 108570225 missense probably benign
R2137:Gak UTSW 5 108606877 splice site probably null
R2138:Gak UTSW 5 108606877 splice site probably null
R2139:Gak UTSW 5 108606877 splice site probably null
R2904:Gak UTSW 5 108624214 missense possibly damaging 0.70
R3080:Gak UTSW 5 108613602 missense possibly damaging 0.90
R3773:Gak UTSW 5 108582672 missense probably benign 0.00
R4523:Gak UTSW 5 108576566 missense probably benign 0.22
R4665:Gak UTSW 5 108582960 missense probably benign
R4703:Gak UTSW 5 108569877 missense probably damaging 0.99
R4890:Gak UTSW 5 108580876 unclassified probably benign
R4951:Gak UTSW 5 108582718 missense probably benign
R4971:Gak UTSW 5 108596806 missense probably damaging 1.00
R5328:Gak UTSW 5 108617001 missense possibly damaging 0.94
R5436:Gak UTSW 5 108592352 missense possibly damaging 0.94
R5496:Gak UTSW 5 108576617 missense probably benign 0.00
R6207:Gak UTSW 5 108625029 critical splice donor site probably null
R6359:Gak UTSW 5 108571900 missense probably damaging 1.00
R6468:Gak UTSW 5 108623336 nonsense probably null
R6682:Gak UTSW 5 108598876 missense probably damaging 1.00
R6915:Gak UTSW 5 108602950 missense probably benign 0.20
R7403:Gak UTSW 5 108613535 missense probably benign 0.00
R7458:Gak UTSW 5 108583074 missense probably benign 0.00
R7522:Gak UTSW 5 108591199 missense possibly damaging 0.95
R7737:Gak UTSW 5 108617008 missense probably benign 0.15
R8437:Gak UTSW 5 108609406 missense probably benign 0.30
R8739:Gak UTSW 5 108591738 missense possibly damaging 0.65
R8954:Gak UTSW 5 108629652 start gained probably benign
X0064:Gak UTSW 5 108613533 nonsense probably null
Z1177:Gak UTSW 5 108585352 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TATGGCCCTTGCAGAATGCTG -3'
(R):5'- TCCAGACCTTGTTGTTCTCAAG -3'

Sequencing Primer
(F):5'- CTGCAACTGTGTGATTAATGCCAG -3'
(R):5'- TTCTCAAGGAACTGGTGCAG -3'
Posted On 2019-10-24