Incidental Mutation 'R7650:Akap13'
ID590754
Institutional Source Beutler Lab
Gene Symbol Akap13
Ensembl Gene ENSMUSG00000066406
Gene NameA kinase (PRKA) anchor protein 13
SynonymsAKAP-Lbc, 5730522G15Rik, 1700026G02Rik, PROTO-LBC, PROTO-LB, Ht31, 5830460E08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7650 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location75455534-75754609 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 75643454 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 45 (V45E)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166315] [ENSMUST00000207750] [ENSMUST00000207923]
Predicted Effect probably benign
Transcript: ENSMUST00000166315
SMART Domains Protein: ENSMUSP00000129784
Gene: ENSMUSG00000066406

DomainStartEndE-ValueType
low complexity region 174 184 N/A INTRINSIC
low complexity region 773 789 N/A INTRINSIC
low complexity region 896 908 N/A INTRINSIC
low complexity region 1021 1032 N/A INTRINSIC
low complexity region 1433 1448 N/A INTRINSIC
low complexity region 1483 1505 N/A INTRINSIC
low complexity region 1583 1594 N/A INTRINSIC
low complexity region 1720 1750 N/A INTRINSIC
C1 1755 1801 1.95e-4 SMART
low complexity region 1858 1869 N/A INTRINSIC
RhoGEF 1961 2153 1.28e-61 SMART
PH 2195 2298 2.94e-11 SMART
coiled coil region 2308 2345 N/A INTRINSIC
low complexity region 2393 2412 N/A INTRINSIC
low complexity region 2444 2454 N/A INTRINSIC
coiled coil region 2533 2646 N/A INTRINSIC
low complexity region 2728 2734 N/A INTRINSIC
low complexity region 2740 2753 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207750
Predicted Effect probably benign
Transcript: ENSMUST00000207923
Predicted Effect probably benign
Transcript: ENSMUST00000207998
AA Change: V45E

PolyPhen 2 Score 0.201 (Sensitivity: 0.92; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000208708
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms containing c-terminal dbl oncogene homology (DH) and pleckstrin homology (PH) domains. The DH domain is associated with guanine nucleotide exchange activation for the Rho/Rac family of small GTP binding proteins, resulting in the conversion of the inactive GTPase to the active form capable of transducing signals. The PH domain has multiple functions. Therefore, these isoforms function as scaffolding proteins to coordinate a Rho signaling pathway, function as protein kinase A-anchoring proteins and, in addition, enhance ligand-dependent activity of estrogen receptors alpha and beta. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis, arrested heart development, and forebrain hypoplasia. Heterozygous mice exhibit small spleen, impaired lymphocyte response to osmotic stress, decreased response to glucocorticoid, osteoporosis and impared osteogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002J24Rik G A 7: 30,699,789 V3I probably benign Het
Adam33 T C 2: 131,061,147 E59G probably damaging Het
Ap1s1 A G 5: 137,045,533 S28P probably benign Het
Btnl2 T C 17: 34,358,129 L86P probably damaging Het
Carm1 G A 9: 21,580,372 V246I probably benign Het
Cdk5rap1 C T 2: 154,354,116 D283N probably benign Het
Cfap58 C A 19: 47,986,528 N709K possibly damaging Het
Col24a1 A G 3: 145,314,453 D195G probably benign Het
Dcaf1 A G 9: 106,838,344 D220G probably benign Het
Ddias C T 7: 92,858,935 G591R probably benign Het
Defb22 A T 2: 152,486,103 I54K probably benign Het
Dennd4b G A 3: 90,268,749 W202* probably null Het
F2 T C 2: 91,628,396 N523S possibly damaging Het
Fam186a A G 15: 99,939,907 Y2819H unknown Het
Fanca A T 8: 123,268,564 probably null Het
Fezf2 T C 14: 12,342,653 H404R probably damaging Het
Fry A G 5: 150,413,418 N1418S probably damaging Het
Gak A G 5: 108,584,295 S776P probably benign Het
Gbf1 A G 19: 46,272,539 H1181R probably damaging Het
Gdf9 G A 11: 53,437,098 E294K probably benign Het
Gje1 G A 10: 14,716,424 R205* probably null Het
Gm12569 G A 11: 51,234,786 E179K possibly damaging Het
Gm8206 T C 14: 6,055,211 probably null Het
Gpr162 T A 6: 124,861,843 probably benign Het
Gxylt1 C T 15: 93,245,658 R363H probably benign Het
Hnrnph1 A T 11: 50,383,899 M396L probably benign Het
Ice1 A G 13: 70,589,797 V2177A possibly damaging Het
Ice1 T A 13: 70,605,483 Q828L probably damaging Het
Il10 A T 1: 131,021,455 T118S probably benign Het
Itpr2 C T 6: 146,233,994 R1813Q probably benign Het
Kbtbd12 T A 6: 88,618,548 Q100L probably damaging Het
Kin A G 2: 10,092,168 D276G possibly damaging Het
Klhl1 T C 14: 96,346,943 T284A probably damaging Het
Kmt2d C T 15: 98,850,870 A2858T unknown Het
Krt8 G A 15: 102,004,163 T26M probably benign Het
Lama3 T A 18: 12,537,838 M827K probably benign Het
Lingo3 T C 10: 80,835,763 N111S probably damaging Het
Megf10 GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA GGCAGCAACAGCACCAGCAGCA 18: 57,293,999 probably benign Het
Metap1 A G 3: 138,466,367 V263A probably damaging Het
Muc5ac A G 7: 141,809,422 T2157A unknown Het
Myo1d G T 11: 80,601,684 H748Q probably benign Het
Nfkbiz A T 16: 55,817,839 N419K probably benign Het
Nol10 T C 12: 17,362,682 probably null Het
Nrcam T C 12: 44,547,322 L284P probably damaging Het
Nrp1 T A 8: 128,498,014 W753R possibly damaging Het
Obscn A G 11: 59,060,994 S3978P probably benign Het
Olfr181 T A 16: 58,926,053 R173* probably null Het
Olfr968 A T 9: 39,771,873 F309Y probably benign Het
Opa3 C A 7: 19,244,971 N120K probably benign Het
Pabpc1l T C 2: 164,049,590 L576S probably benign Het
Panx3 A G 9: 37,661,405 L283S probably damaging Het
Pcdhb4 T A 18: 37,309,614 V659E probably damaging Het
Pde4dip A T 3: 97,699,107 probably null Het
Pkd1l3 T C 8: 109,672,585 V2200A probably benign Het
Pkp3 G A 7: 141,082,370 M112I probably benign Het
Prex2 T C 1: 11,149,854 I683T possibly damaging Het
Psg22 C A 7: 18,726,759 Q438K possibly damaging Het
Ptgir T C 7: 16,906,951 V56A possibly damaging Het
Pus7 G T 5: 23,760,246 T304K probably damaging Het
Rab38 T C 7: 88,430,429 Y10H possibly damaging Het
Ros1 C T 10: 52,046,209 G2277D probably benign Het
Rpain A T 11: 70,970,445 probably benign Het
Shh C A 5: 28,458,306 S288I probably benign Het
Slc26a5 C T 5: 21,834,330 V259M possibly damaging Het
Slc4a7 G A 14: 14,773,348 E773K probably benign Het
Slit1 T A 19: 41,629,924 N771I probably damaging Het
Stim1 T A 7: 102,428,827 S179T Het
Syk A G 13: 52,611,095 D86G probably benign Het
Tmem132b T G 5: 125,787,010 S727A probably benign Het
Trim42 T A 9: 97,363,148 Y533F probably benign Het
Trpm6 A T 19: 18,876,013 D1799V possibly damaging Het
Ttc26 T A 6: 38,395,040 N188K probably benign Het
Ube4a A T 9: 44,933,436 I839N probably damaging Het
Ugt2b36 A G 5: 87,080,972 I404T probably damaging Het
Ushbp1 T A 8: 71,390,924 Q290L possibly damaging Het
Vcl T A 14: 20,995,046 I273K probably damaging Het
Vmn2r73 T A 7: 85,871,939 I274L probably benign Het
Zc3h7b A G 15: 81,793,650 D945G possibly damaging Het
Zfp454 A G 11: 50,883,753 L31P probably damaging Het
Zfp536 C A 7: 37,569,692 V100L probably damaging Het
Zfp942 A T 17: 21,928,837 S270R probably benign Het
Other mutations in Akap13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Akap13 APN 7 75725971 missense probably damaging 0.99
IGL00332:Akap13 APN 7 75728919 missense probably damaging 1.00
IGL00481:Akap13 APN 7 75723895 missense probably damaging 1.00
IGL00590:Akap13 APN 7 75610669 missense probably benign 0.01
IGL00655:Akap13 APN 7 75704398 missense probably damaging 0.99
IGL00766:Akap13 APN 7 75704512 missense probably damaging 0.96
IGL00818:Akap13 APN 7 75609727 missense probably benign 0.00
IGL00826:Akap13 APN 7 75677447 missense probably damaging 1.00
IGL01014:Akap13 APN 7 75750633 utr 3 prime probably benign
IGL01090:Akap13 APN 7 75666531 missense probably benign 0.44
IGL01155:Akap13 APN 7 75569936 missense probably damaging 1.00
IGL01326:Akap13 APN 7 75725348 missense probably benign 0.30
IGL01456:Akap13 APN 7 75602847 missense probably damaging 0.98
IGL01460:Akap13 APN 7 75747846 missense probably benign 0.29
IGL01568:Akap13 APN 7 75608522 nonsense probably null 0.00
IGL01610:Akap13 APN 7 75720180 missense possibly damaging 0.71
IGL01610:Akap13 APN 7 75747605 missense probably damaging 1.00
IGL01615:Akap13 APN 7 75697393 missense probably damaging 1.00
IGL01667:Akap13 APN 7 75570019 missense probably damaging 1.00
IGL01705:Akap13 APN 7 75746767 missense possibly damaging 0.86
IGL02070:Akap13 APN 7 75666545 missense probably benign 0.27
IGL02269:Akap13 APN 7 75602911 missense probably benign
IGL02421:Akap13 APN 7 75717806 missense possibly damaging 0.66
IGL02870:Akap13 APN 7 75609188 missense probably damaging 0.96
IGL02944:Akap13 APN 7 75608657 missense probably benign
IGL03051:Akap13 APN 7 75610485 nonsense probably null
IGL03160:Akap13 APN 7 75730417 missense probably damaging 1.00
IGL03245:Akap13 APN 7 75609752 missense probably damaging 0.99
R0254:Akap13 UTSW 7 75736604 splice site probably benign
R0310:Akap13 UTSW 7 75614930 missense probably damaging 0.99
R0373:Akap13 UTSW 7 75609929 missense probably benign 0.00
R0373:Akap13 UTSW 7 75730500 missense probably damaging 1.00
R0408:Akap13 UTSW 7 75746796 missense probably damaging 1.00
R0631:Akap13 UTSW 7 75614996 missense probably damaging 0.99
R0646:Akap13 UTSW 7 75747746 missense probably damaging 1.00
R0781:Akap13 UTSW 7 75611377 missense possibly damaging 0.56
R0845:Akap13 UTSW 7 75725380 missense probably damaging 1.00
R1004:Akap13 UTSW 7 75687286 missense probably damaging 0.99
R1024:Akap13 UTSW 7 75677409 missense probably damaging 1.00
R1110:Akap13 UTSW 7 75611377 missense possibly damaging 0.56
R1346:Akap13 UTSW 7 75609592 missense possibly damaging 0.67
R1349:Akap13 UTSW 7 75609592 missense possibly damaging 0.67
R1372:Akap13 UTSW 7 75609592 missense possibly damaging 0.67
R1387:Akap13 UTSW 7 75586193 missense probably damaging 0.97
R1442:Akap13 UTSW 7 75735778 missense probably damaging 0.99
R1466:Akap13 UTSW 7 75729049 missense possibly damaging 0.79
R1466:Akap13 UTSW 7 75729049 missense possibly damaging 0.79
R1584:Akap13 UTSW 7 75729049 missense possibly damaging 0.79
R1696:Akap13 UTSW 7 75609592 missense possibly damaging 0.67
R1738:Akap13 UTSW 7 75677194 missense probably damaging 1.00
R1773:Akap13 UTSW 7 75683451 missense possibly damaging 0.80
R1785:Akap13 UTSW 7 75611434 missense probably benign 0.16
R1786:Akap13 UTSW 7 75611434 missense probably benign 0.16
R1791:Akap13 UTSW 7 75611035 missense probably benign 0.00
R1819:Akap13 UTSW 7 75608705 missense probably benign 0.04
R1879:Akap13 UTSW 7 75610727 missense probably benign 0.01
R1989:Akap13 UTSW 7 75704516 missense probably benign 0.01
R2016:Akap13 UTSW 7 75704531 missense probably damaging 0.99
R2092:Akap13 UTSW 7 75610570 missense probably benign 0.05
R2126:Akap13 UTSW 7 75725304 missense possibly damaging 0.95
R2131:Akap13 UTSW 7 75611434 missense probably benign 0.16
R2132:Akap13 UTSW 7 75611434 missense probably benign 0.16
R2133:Akap13 UTSW 7 75611434 missense probably benign 0.16
R2251:Akap13 UTSW 7 75739477 missense possibly damaging 0.50
R3704:Akap13 UTSW 7 75666550 missense probably damaging 1.00
R3713:Akap13 UTSW 7 75586181 missense probably damaging 0.98
R3731:Akap13 UTSW 7 75611377 missense probably benign 0.39
R3765:Akap13 UTSW 7 75608837 missense probably benign 0.04
R3788:Akap13 UTSW 7 75702153 critical splice donor site probably null
R3793:Akap13 UTSW 7 75610141 missense probably benign 0.00
R3970:Akap13 UTSW 7 75569951 nonsense probably null
R4205:Akap13 UTSW 7 75610919 missense probably benign 0.05
R4257:Akap13 UTSW 7 75611285 missense probably damaging 0.98
R4374:Akap13 UTSW 7 75608984 missense probably damaging 0.96
R4448:Akap13 UTSW 7 75742760 missense probably damaging 1.00
R4450:Akap13 UTSW 7 75742760 missense probably damaging 1.00
R4457:Akap13 UTSW 7 75739465 missense probably damaging 0.99
R4458:Akap13 UTSW 7 75739465 missense probably damaging 0.99
R4466:Akap13 UTSW 7 75602773 splice site probably null
R4632:Akap13 UTSW 7 75666553 missense possibly damaging 0.91
R4667:Akap13 UTSW 7 75729094 missense probably damaging 1.00
R4669:Akap13 UTSW 7 75729094 missense probably damaging 1.00
R4671:Akap13 UTSW 7 75579564 nonsense probably null
R4821:Akap13 UTSW 7 75677507 intron probably benign
R4868:Akap13 UTSW 7 75743504 missense probably damaging 1.00
R4894:Akap13 UTSW 7 75725320 missense possibly damaging 0.76
R4943:Akap13 UTSW 7 75749240 missense probably benign 0.22
R4962:Akap13 UTSW 7 75749430 missense probably damaging 0.98
R4988:Akap13 UTSW 7 75730528 missense probably damaging 1.00
R5119:Akap13 UTSW 7 75687252 missense probably damaging 0.98
R5141:Akap13 UTSW 7 75609614 missense probably benign 0.18
R5419:Akap13 UTSW 7 75610243 missense probably benign 0.01
R5427:Akap13 UTSW 7 75728869 missense possibly damaging 0.89
R5429:Akap13 UTSW 7 75602904 missense possibly damaging 0.70
R5432:Akap13 UTSW 7 75602830 missense probably damaging 1.00
R5458:Akap13 UTSW 7 75586301 missense probably damaging 1.00
R5636:Akap13 UTSW 7 75704372 missense probably damaging 0.96
R5643:Akap13 UTSW 7 75702154 critical splice donor site probably null
R5898:Akap13 UTSW 7 75729146 missense probably damaging 1.00
R5932:Akap13 UTSW 7 75610184 missense probably damaging 1.00
R6135:Akap13 UTSW 7 75609908 missense possibly damaging 0.94
R6137:Akap13 UTSW 7 75677416 missense probably damaging 1.00
R6182:Akap13 UTSW 7 75586280 missense probably benign 0.45
R6310:Akap13 UTSW 7 75749193 missense probably damaging 0.99
R6346:Akap13 UTSW 7 75685254 missense probably damaging 1.00
R6466:Akap13 UTSW 7 75727044 missense probably benign 0.01
R6605:Akap13 UTSW 7 75579768 missense probably damaging 0.98
R6617:Akap13 UTSW 7 75730363 missense possibly damaging 0.95
R6621:Akap13 UTSW 7 75569981 missense probably damaging 1.00
R6703:Akap13 UTSW 7 75602898 missense probably damaging 1.00
R6750:Akap13 UTSW 7 75739458 missense probably benign 0.03
R7069:Akap13 UTSW 7 75610262 missense probably benign 0.29
R7116:Akap13 UTSW 7 75720195 missense probably benign 0.00
R7158:Akap13 UTSW 7 75579594 missense probably damaging 0.97
R7159:Akap13 UTSW 7 75730579 missense possibly damaging 0.72
R7467:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R7468:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R7471:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R7472:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R7477:Akap13 UTSW 7 75749247 missense probably benign
R7636:Akap13 UTSW 7 75609873 missense probably benign 0.04
R7671:Akap13 UTSW 7 75569900 missense probably damaging 1.00
R7681:Akap13 UTSW 7 75728796 missense possibly damaging 0.91
R7752:Akap13 UTSW 7 75677258 missense possibly damaging 0.74
R7784:Akap13 UTSW 7 75610328 missense probably benign 0.00
R7816:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R7817:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R7834:Akap13 UTSW 7 75742642 missense possibly damaging 0.85
R7880:Akap13 UTSW 7 75586216 missense probably damaging 0.97
R7942:Akap13 UTSW 7 75611470 missense possibly damaging 0.50
R8006:Akap13 UTSW 7 75579696 missense probably damaging 1.00
R8009:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R8011:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R8012:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R8013:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R8016:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R8089:Akap13 UTSW 7 75610592 missense possibly damaging 0.94
R8138:Akap13 UTSW 7 75702231 splice site probably null
R8174:Akap13 UTSW 7 75728869 missense possibly damaging 0.89
R8298:Akap13 UTSW 7 75747804 missense probably damaging 1.00
R8444:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R8445:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R8512:Akap13 UTSW 7 75611086 missense probably damaging 0.99
Z1176:Akap13 UTSW 7 75730552 missense probably damaging 0.99
Z1177:Akap13 UTSW 7 75615005 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- ATCTGGAAGCAGAAGTCTCCTC -3'
(R):5'- TCTCTGTTCAGACATGCCTTTAAAG -3'

Sequencing Primer
(F):5'- CCCGCCCACTGTGAGAATTTG -3'
(R):5'- TTTAAAGAACTTTAAATCCCCCACC -3'
Posted On2019-10-24