Mutagenetix > Incidental Mutation

Incidental Mutation 'R7650:Stim1'

590758

Institutional Source

Beutler Lab

Gene Symbol

Stim1

Ensembl Gene

ENSMUSG00000030987

Gene Name

stromal interaction molecule 1

Synonyms

SIM

MMRRC Submission

045727-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7650 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

102267806-102437319 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 102428827 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 179 (S179T)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033289] [ENSMUST00000209255] [ENSMUST00000211457]

AlphaFold

P70302

Predicted Effect

probably benign
Transcript: ENSMUST00000033289

SMART Domains

Protein: ENSMUSP00000033289
Gene: ENSMUSG00000030987

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	32	47	N/A	INTRINSIC
SAM	129	200	5.51e-6	SMART
SCOP:d1eq1a_	229	334	1e-2	SMART
PDB:4O9B\|D	237	340	3e-59	PDB
Pfam:SOAR	341	441	1.4e-46	PFAM
low complexity region	485	499	N/A	INTRINSIC
low complexity region	601	631	N/A	INTRINSIC
low complexity region	672	685	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000209255

Predicted Effect

probably benign
Transcript: ENSMUST00000211457

Meta Mutation Damage Score

0.0869

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

100% (80/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type 1 transmembrane protein that mediates Ca2+ influx after depletion of intracellular Ca2+ stores by gating of store-operated Ca2+ influx channels (SOCs). It is one of several genes located in the imprinted gene domain of 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocrotical carcinoma, and lung, ovarian, and breast cancer. This gene may play a role in malignancies and disease that involve this region, as well as early hematopoiesis, by mediating attachment to stromal cells. Mutations in this gene are associated with fatal classic Kaposi sarcoma, immunodeficiency due to defects in store-operated calcium entry (SOCE) in fibroblasts, ectodermal dysplasia and tubular aggregate myopathy. This gene is oriented in a head-to-tail configuration with the ribonucleotide reductase 1 gene (RRM1), with the 3' end of this gene situated 1.6 kb from the 5' end of the RRM1 gene. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit perinatal and postnatal lethality, with all mice dying by 2 weeks of age, and severe growth retardation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2200002J24Rik	G	A	7: 30,699,789	V3I	probably benign	Het
Adam33	T	C	2: 131,061,147	E59G	probably damaging	Het
Akap13	T	A	7: 75,643,454	V45E	probably benign	Het
Ap1s1	A	G	5: 137,045,533	S28P	probably benign	Het
Btnl2	T	C	17: 34,358,129	L86P	probably damaging	Het
Carm1	G	A	9: 21,580,372	V246I	probably benign	Het
Cdk5rap1	C	T	2: 154,354,116	D283N	probably benign	Het
Cfap58	C	A	19: 47,986,528	N709K	possibly damaging	Het
Col24a1	A	G	3: 145,314,453	D195G	probably benign	Het
Dcaf1	A	G	9: 106,838,344	D220G	probably benign	Het
Ddias	C	T	7: 92,858,935	G591R	probably benign	Het
Defb22	A	T	2: 152,486,103	I54K	probably benign	Het
Dennd4b	G	A	3: 90,268,749	W202*	probably null	Het
F2	T	C	2: 91,628,396	N523S	possibly damaging	Het
Fam186a	A	G	15: 99,939,907	Y2819H	unknown	Het
Fanca	A	T	8: 123,268,564		probably null	Het
Fezf2	T	C	14: 12,342,653	H404R	probably damaging	Het
Fry	A	G	5: 150,413,418	N1418S	probably damaging	Het
Gak	A	G	5: 108,584,295	S776P	probably benign	Het
Gbf1	A	G	19: 46,272,539	H1181R	probably damaging	Het
Gdf9	G	A	11: 53,437,098	E294K	probably benign	Het
Gje1	G	A	10: 14,716,424	R205*	probably null	Het
Gm12569	G	A	11: 51,234,786	E179K	possibly damaging	Het
Gm8206	T	C	14: 6,055,211		probably null	Het
Gpr162	T	A	6: 124,861,843		probably benign	Het
Gxylt1	C	T	15: 93,245,658	R363H	probably benign	Het
Hnrnph1	A	T	11: 50,383,899	M396L	probably benign	Het
Ice1	A	G	13: 70,589,797	V2177A	possibly damaging	Het
Ice1	T	A	13: 70,605,483	Q828L	probably damaging	Het
Il10	A	T	1: 131,021,455	T118S	probably benign	Het
Itpr2	C	T	6: 146,233,994	R1813Q	probably benign	Het
Kbtbd12	T	A	6: 88,618,548	Q100L	probably damaging	Het
Kin	A	G	2: 10,092,168	D276G	possibly damaging	Het
Klhl1	T	C	14: 96,346,943	T284A	probably damaging	Het
Kmt2d	C	T	15: 98,850,870	A2858T	unknown	Het
Krt8	G	A	15: 102,004,163	T26M	probably benign	Het
Lama3	T	A	18: 12,537,838	M827K	probably benign	Het
Lingo3	T	C	10: 80,835,763	N111S	probably damaging	Het
Megf10	GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA	GGCAGCAACAGCACCAGCAGCA	18: 57,293,999		probably benign	Het
Metap1	A	G	3: 138,466,367	V263A	probably damaging	Het
Muc5ac	A	G	7: 141,809,422	T2157A	unknown	Het
Myo1d	G	T	11: 80,601,684	H748Q	probably benign	Het
Nfkbiz	A	T	16: 55,817,839	N419K	probably benign	Het
Nol10	T	C	12: 17,362,682		probably null	Het
Nrcam	T	C	12: 44,547,322	L284P	probably damaging	Het
Nrp1	T	A	8: 128,498,014	W753R	possibly damaging	Het
Obscn	A	G	11: 59,060,994	S3978P	probably benign	Het
Olfr181	T	A	16: 58,926,053	R173*	probably null	Het
Olfr968	A	T	9: 39,771,873	F309Y	probably benign	Het
Opa3	C	A	7: 19,244,971	N120K	probably benign	Het
Pabpc1l	T	C	2: 164,049,590	L576S	probably benign	Het
Panx3	A	G	9: 37,661,405	L283S	probably damaging	Het
Pcdhb4	T	A	18: 37,309,614	V659E	probably damaging	Het
Pde4dip	A	T	3: 97,699,107		probably null	Het
Pkd1l3	T	C	8: 109,672,585	V2200A	probably benign	Het
Pkp3	G	A	7: 141,082,370	M112I	probably benign	Het
Prex2	T	C	1: 11,149,854	I683T	possibly damaging	Het
Psg22	C	A	7: 18,726,759	Q438K	possibly damaging	Het
Ptgir	T	C	7: 16,906,951	V56A	possibly damaging	Het
Pus7	G	T	5: 23,760,246	T304K	probably damaging	Het
Rab38	T	C	7: 88,430,429	Y10H	possibly damaging	Het
Ros1	C	T	10: 52,046,209	G2277D	probably benign	Het
Rpain	A	T	11: 70,970,445		probably benign	Het
Shh	C	A	5: 28,458,306	S288I	probably benign	Het
Slc26a5	C	T	5: 21,834,330	V259M	possibly damaging	Het
Slc4a7	G	A	14: 14,773,348	E773K	probably benign	Het
Slit1	T	A	19: 41,629,924	N771I	probably damaging	Het
Syk	A	G	13: 52,611,095	D86G	probably benign	Het
Tmem132b	T	G	5: 125,787,010	S727A	probably benign	Het
Trim42	T	A	9: 97,363,148	Y533F	probably benign	Het
Trpm6	A	T	19: 18,876,013	D1799V	possibly damaging	Het
Ttc26	T	A	6: 38,395,040	N188K	probably benign	Het
Ube4a	A	T	9: 44,933,436	I839N	probably damaging	Het
Ugt2b36	A	G	5: 87,080,972	I404T	probably damaging	Het
Ushbp1	T	A	8: 71,390,924	Q290L	possibly damaging	Het
Vcl	T	A	14: 20,995,046	I273K	probably damaging	Het
Vmn2r73	T	A	7: 85,871,939	I274L	probably benign	Het
Zc3h7b	A	G	15: 81,793,650	D945G	possibly damaging	Het
Zfp454	A	G	11: 50,883,753	L31P	probably damaging	Het
Zfp536	C	A	7: 37,569,692	V100L	probably damaging	Het
Zfp942	A	T	17: 21,928,837	S270R	probably benign	Het

Other mutations in Stim1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Stim1	APN	7	102426747	missense	probably damaging	1.00
IGL01390:Stim1	APN	7	102427162	missense	possibly damaging	0.73
IGL01602:Stim1	APN	7	102386115	missense	possibly damaging	0.86
IGL01605:Stim1	APN	7	102386115	missense	possibly damaging	0.86
IGL01697:Stim1	APN	7	102425969	splice site	probably benign
IGL01826:Stim1	APN	7	102427075	splice site	probably benign
IGL01908:Stim1	APN	7	102435650	missense	probably benign
IGL02869:Stim1	APN	7	102268551	missense	unknown
IGL03146:Stim1	APN	7	102421355	missense	probably damaging	1.00
R0217:Stim1	UTSW	7	102435800	missense	probably benign	0.00
R1320:Stim1	UTSW	7	102408406	missense	possibly damaging	0.79
R1639:Stim1	UTSW	7	102354541	missense	probably benign	0.31
R1643:Stim1	UTSW	7	102386100	missense	possibly damaging	0.92
R1697:Stim1	UTSW	7	102354506	missense	probably damaging	1.00
R2424:Stim1	UTSW	7	102408405	missense	probably benign	0.03
R3838:Stim1	UTSW	7	102411296	missense	possibly damaging	0.71
R3940:Stim1	UTSW	7	102435641	missense	probably benign	0.00
R4820:Stim1	UTSW	7	102415364	missense	probably damaging	0.97
R4871:Stim1	UTSW	7	102354572	missense	probably damaging	1.00
R5110:Stim1	UTSW	7	102268422	missense	unknown
R5787:Stim1	UTSW	7	102435440	missense	possibly damaging	0.52
R6400:Stim1	UTSW	7	102430950	missense	probably null	0.99
R6788:Stim1	UTSW	7	102427291	missense	probably damaging	0.99
R7112:Stim1	UTSW	7	102408408	missense	probably benign	0.01
R7125:Stim1	UTSW	7	102435534	missense	possibly damaging	0.69
R7247:Stim1	UTSW	7	102421532	critical splice donor site	probably null
R7807:Stim1	UTSW	7	102427141	missense	probably damaging	0.99
R8304:Stim1	UTSW	7	102435481	missense	possibly damaging	0.55
R8462:Stim1	UTSW	7	102427117	missense	probably damaging	1.00
R8528:Stim1	UTSW	7	102431082	intron	probably benign
R8883:Stim1	UTSW	7	102431050	missense	unknown
R8921:Stim1	UTSW	7	102421390	missense	probably damaging	0.99
R8924:Stim1	UTSW	7	102428807	missense
R9018:Stim1	UTSW	7	102411275	missense	probably benign	0.05
R9164:Stim1	UTSW	7	102435419	missense	probably benign	0.35
R9396:Stim1	UTSW	7	102415385	missense	possibly damaging	0.63
R9487:Stim1	UTSW	7	102431050	missense	unknown
R9501:Stim1	UTSW	7	102411299	missense	possibly damaging	0.92
R9697:Stim1	UTSW	7	102428807	missense
R9710:Stim1	UTSW	7	102430911	small deletion	probably benign
R9734:Stim1	UTSW	7	102415353	missense	possibly damaging	0.56

Predicted Primers

PCR Primer
(F):5'- GATCCAATGCTCCCATGCTC -3'
(R):5'- CCCTCCCTTCAGTTAGTAAGGAC -3'

Sequencing Primer
(F):5'- CTCTCCGGGTTAGGGAAAAGCTTC -3'
(R):5'- CCCTTCAGTTAGTAAGGACAGTGC -3'

Posted On

2019-10-24