Incidental Mutation 'R7650:Pkp3'
ID590759
Institutional Source Beutler Lab
Gene Symbol Pkp3
Ensembl Gene ENSMUSG00000054065
Gene Nameplakophilin 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R7650 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location141078218-141090510 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 141082370 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 112 (M112I)
Ref Sequence ENSEMBL: ENSMUSP00000101654 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066873] [ENSMUST00000106039] [ENSMUST00000159375] [ENSMUST00000160869] [ENSMUST00000163041]
Predicted Effect probably benign
Transcript: ENSMUST00000066873
AA Change: M87I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000069961
Gene: ENSMUSG00000054065
AA Change: M87I

DomainStartEndE-ValueType
low complexity region 40 54 N/A INTRINSIC
low complexity region 139 150 N/A INTRINSIC
low complexity region 179 194 N/A INTRINSIC
low complexity region 219 228 N/A INTRINSIC
ARM 350 390 8.11e-5 SMART
ARM 392 432 3.24e-4 SMART
ARM 489 536 3.85e0 SMART
internal_repeat_1 605 702 2.91e-9 PROSPERO
low complexity region 717 731 N/A INTRINSIC
low complexity region 757 774 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106039
AA Change: M112I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000101654
Gene: ENSMUSG00000054065
AA Change: M112I

DomainStartEndE-ValueType
low complexity region 65 79 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 204 219 N/A INTRINSIC
low complexity region 244 253 N/A INTRINSIC
ARM 375 415 8.11e-5 SMART
ARM 417 457 3.24e-4 SMART
ARM 514 561 3.85e0 SMART
internal_repeat_1 630 727 4.99e-9 PROSPERO
low complexity region 742 756 N/A INTRINSIC
low complexity region 782 799 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159375
AA Change: M9I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000160869
SMART Domains Protein: ENSMUSP00000124013
Gene: ENSMUSG00000054065

DomainStartEndE-ValueType
low complexity region 40 54 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163041
AA Change: M9I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124434
Gene: ENSMUSG00000054065
AA Change: M9I

DomainStartEndE-ValueType
low complexity region 61 72 N/A INTRINSIC
low complexity region 101 116 N/A INTRINSIC
low complexity region 141 150 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the arm-repeat (armadillo) and plakophilin gene families. Plakophilin proteins contain numerous armadillo repeats, localize to cell desmosomes and nuclei, and participate in linking cadherins to intermediate filaments in the cytoskeleton. This protein may act in cellular desmosome-dependent adhesion and signaling pathways. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit retarded hair growth, epidermal thickening and abnormal hair follicles that lead to secondary alopecia and acute dermatitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002J24Rik G A 7: 30,699,789 V3I probably benign Het
Adam33 T C 2: 131,061,147 E59G probably damaging Het
Akap13 T A 7: 75,643,454 V45E probably benign Het
Ap1s1 A G 5: 137,045,533 S28P probably benign Het
Btnl2 T C 17: 34,358,129 L86P probably damaging Het
Carm1 G A 9: 21,580,372 V246I probably benign Het
Cdk5rap1 C T 2: 154,354,116 D283N probably benign Het
Cfap58 C A 19: 47,986,528 N709K possibly damaging Het
Col24a1 A G 3: 145,314,453 D195G probably benign Het
Dcaf1 A G 9: 106,838,344 D220G probably benign Het
Ddias C T 7: 92,858,935 G591R probably benign Het
Defb22 A T 2: 152,486,103 I54K probably benign Het
Dennd4b G A 3: 90,268,749 W202* probably null Het
F2 T C 2: 91,628,396 N523S possibly damaging Het
Fam186a A G 15: 99,939,907 Y2819H unknown Het
Fanca A T 8: 123,268,564 probably null Het
Fezf2 T C 14: 12,342,653 H404R probably damaging Het
Fry A G 5: 150,413,418 N1418S probably damaging Het
Gak A G 5: 108,584,295 S776P probably benign Het
Gbf1 A G 19: 46,272,539 H1181R probably damaging Het
Gdf9 G A 11: 53,437,098 E294K probably benign Het
Gje1 G A 10: 14,716,424 R205* probably null Het
Gm12569 G A 11: 51,234,786 E179K possibly damaging Het
Gm8206 T C 14: 6,055,211 probably null Het
Gpr162 T A 6: 124,861,843 probably benign Het
Gxylt1 C T 15: 93,245,658 R363H probably benign Het
Hnrnph1 A T 11: 50,383,899 M396L probably benign Het
Ice1 A G 13: 70,589,797 V2177A possibly damaging Het
Ice1 T A 13: 70,605,483 Q828L probably damaging Het
Il10 A T 1: 131,021,455 T118S probably benign Het
Itpr2 C T 6: 146,233,994 R1813Q probably benign Het
Kbtbd12 T A 6: 88,618,548 Q100L probably damaging Het
Kin A G 2: 10,092,168 D276G possibly damaging Het
Klhl1 T C 14: 96,346,943 T284A probably damaging Het
Kmt2d C T 15: 98,850,870 A2858T unknown Het
Krt8 G A 15: 102,004,163 T26M probably benign Het
Lama3 T A 18: 12,537,838 M827K probably benign Het
Lingo3 T C 10: 80,835,763 N111S probably damaging Het
Megf10 GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA GGCAGCAACAGCACCAGCAGCA 18: 57,293,999 probably benign Het
Metap1 A G 3: 138,466,367 V263A probably damaging Het
Muc5ac A G 7: 141,809,422 T2157A unknown Het
Myo1d G T 11: 80,601,684 H748Q probably benign Het
Nfkbiz A T 16: 55,817,839 N419K probably benign Het
Nol10 T C 12: 17,362,682 probably null Het
Nrcam T C 12: 44,547,322 L284P probably damaging Het
Nrp1 T A 8: 128,498,014 W753R possibly damaging Het
Obscn A G 11: 59,060,994 S3978P probably benign Het
Olfr181 T A 16: 58,926,053 R173* probably null Het
Olfr968 A T 9: 39,771,873 F309Y probably benign Het
Opa3 C A 7: 19,244,971 N120K probably benign Het
Pabpc1l T C 2: 164,049,590 L576S probably benign Het
Panx3 A G 9: 37,661,405 L283S probably damaging Het
Pcdhb4 T A 18: 37,309,614 V659E probably damaging Het
Pde4dip A T 3: 97,699,107 probably null Het
Pkd1l3 T C 8: 109,672,585 V2200A probably benign Het
Prex2 T C 1: 11,149,854 I683T possibly damaging Het
Psg22 C A 7: 18,726,759 Q438K possibly damaging Het
Ptgir T C 7: 16,906,951 V56A possibly damaging Het
Pus7 G T 5: 23,760,246 T304K probably damaging Het
Rab38 T C 7: 88,430,429 Y10H possibly damaging Het
Ros1 C T 10: 52,046,209 G2277D probably benign Het
Rpain A T 11: 70,970,445 probably benign Het
Shh C A 5: 28,458,306 S288I probably benign Het
Slc26a5 C T 5: 21,834,330 V259M possibly damaging Het
Slc4a7 G A 14: 14,773,348 E773K probably benign Het
Slit1 T A 19: 41,629,924 N771I probably damaging Het
Stim1 T A 7: 102,428,827 S179T Het
Syk A G 13: 52,611,095 D86G probably benign Het
Tmem132b T G 5: 125,787,010 S727A probably benign Het
Trim42 T A 9: 97,363,148 Y533F probably benign Het
Trpm6 A T 19: 18,876,013 D1799V possibly damaging Het
Ttc26 T A 6: 38,395,040 N188K probably benign Het
Ube4a A T 9: 44,933,436 I839N probably damaging Het
Ugt2b36 A G 5: 87,080,972 I404T probably damaging Het
Ushbp1 T A 8: 71,390,924 Q290L possibly damaging Het
Vcl T A 14: 20,995,046 I273K probably damaging Het
Vmn2r73 T A 7: 85,871,939 I274L probably benign Het
Zc3h7b A G 15: 81,793,650 D945G possibly damaging Het
Zfp454 A G 11: 50,883,753 L31P probably damaging Het
Zfp536 C A 7: 37,569,692 V100L probably damaging Het
Zfp942 A T 17: 21,928,837 S270R probably benign Het
Other mutations in Pkp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Pkp3 APN 7 141084182 nonsense probably null
IGL01367:Pkp3 APN 7 141084076 missense probably damaging 1.00
IGL01793:Pkp3 APN 7 141088904 missense probably benign 0.01
IGL02140:Pkp3 APN 7 141089336 missense probably damaging 1.00
IGL02231:Pkp3 APN 7 141084238 missense probably damaging 1.00
IGL02708:Pkp3 APN 7 141089768 unclassified probably benign
IGL02755:Pkp3 APN 7 141088405 splice site probably null
IGL03017:Pkp3 APN 7 141083370 missense probably benign 0.12
IGL03351:Pkp3 APN 7 141082693 missense probably benign
PIT4514001:Pkp3 UTSW 7 141089710 missense probably damaging 0.99
R0145:Pkp3 UTSW 7 141089763 critical splice donor site probably null
R0153:Pkp3 UTSW 7 141083343 missense probably damaging 1.00
R0184:Pkp3 UTSW 7 141088367 missense probably benign 0.41
R1014:Pkp3 UTSW 7 141082826 missense probably benign 0.03
R1664:Pkp3 UTSW 7 141087647 missense probably damaging 1.00
R1844:Pkp3 UTSW 7 141088502 missense probably damaging 1.00
R1891:Pkp3 UTSW 7 141084056 splice site probably null
R2100:Pkp3 UTSW 7 141083292 missense probably damaging 1.00
R3772:Pkp3 UTSW 7 141082346 start codon destroyed probably null
R4003:Pkp3 UTSW 7 141088737 critical splice acceptor site probably null
R4089:Pkp3 UTSW 7 141084143 missense probably damaging 1.00
R4670:Pkp3 UTSW 7 141082699 missense probably benign 0.00
R5266:Pkp3 UTSW 7 141083277 missense probably damaging 1.00
R5619:Pkp3 UTSW 7 141088506 missense probably damaging 1.00
R6113:Pkp3 UTSW 7 141082656 missense probably damaging 0.97
R6820:Pkp3 UTSW 7 141079844 critical splice donor site probably null
R7662:Pkp3 UTSW 7 141078379 missense probably benign 0.03
R8087:Pkp3 UTSW 7 141087638 missense possibly damaging 0.56
R8335:Pkp3 UTSW 7 141087756 missense probably damaging 1.00
X0028:Pkp3 UTSW 7 141089948 splice site probably null
Z1177:Pkp3 UTSW 7 141082735 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGATCTACCAGAACAGACTG -3'
(R):5'- CACAGTGAAGGGGTATCTGG -3'

Sequencing Primer
(F):5'- GGTTAGCTCCCAAACTGACTTGG -3'
(R):5'- ATCTGGGGTTTACCTGGCACC -3'
Posted On2019-10-24