Mutagenetix > Incidental Mutation

Incidental Mutation 'R7650:Nrp1'

590763

Institutional Source

Beutler Lab

Gene Symbol

Nrp1

Ensembl Gene

ENSMUSG00000025810

Gene Name

neuropilin 1

Synonyms

Neuropilin-1, NP-1, NPN-1, Npn1

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7650 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

128358604-128503363 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 128498014 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 753 (W753R)

Ref Sequence

ENSEMBL: ENSMUSP00000026917 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026917]

AlphaFold

P97333

PDB Structure

Mouse Neuropilin-1, extracellular domains 1-4 (a1a2b1b2) [X-RAY DIFFRACTION]
Complex of mouse Plexin A2 - Semaphorin 3A - Neuropilin-1 [X-RAY DIFFRACTION]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000026917
AA Change: W753R

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000026917
Gene: ENSMUSG00000025810
AA Change: W753R

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
CUB	27	141	1.44e-43	SMART
CUB	147	265	9.19e-42	SMART
FA58C	274	424	5.21e-44	SMART
FA58C	430	583	4.15e-20	SMART
low complexity region	587	599	N/A	INTRINSIC
MAM	645	811	4.94e-69	SMART
Pfam:DUF3481	837	920	3.5e-31	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

100% (80/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two neuropilins, which contain specific protein domains which allow them to participate in several different types of signaling pathways that control cell migration. Neuropilins contain a large N-terminal extracellular domain, made up of complement-binding, coagulation factor V/VIII, and meprin domains. These proteins also contains a short membrane-spanning domain and a small cytoplasmic domain. Neuropilins bind many ligands and various types of co-receptors; they affect cell survival, migration, and attraction. Some of the ligands and co-receptors bound by neuropilins are vascular endothelial growth factor (VEGF) and semaphorin family members. Several alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice show embryonic death, impaired neuronal migration and axon guidance, and vascular defects including a disorganized yolk sac vascular plexus, and malformed brachial arch arteries and great vessels. Mice lacking the cytoplasmic domain show altered retinal arteriovenous patterning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2200002J24Rik	G	A	7: 30,699,789	V3I	probably benign	Het
Adam33	T	C	2: 131,061,147	E59G	probably damaging	Het
Akap13	T	A	7: 75,643,454	V45E	probably benign	Het
Ap1s1	A	G	5: 137,045,533	S28P	probably benign	Het
Btnl2	T	C	17: 34,358,129	L86P	probably damaging	Het
Carm1	G	A	9: 21,580,372	V246I	probably benign	Het
Cdk5rap1	C	T	2: 154,354,116	D283N	probably benign	Het
Cfap58	C	A	19: 47,986,528	N709K	possibly damaging	Het
Col24a1	A	G	3: 145,314,453	D195G	probably benign	Het
Dcaf1	A	G	9: 106,838,344	D220G	probably benign	Het
Ddias	C	T	7: 92,858,935	G591R	probably benign	Het
Defb22	A	T	2: 152,486,103	I54K	probably benign	Het
Dennd4b	G	A	3: 90,268,749	W202*	probably null	Het
F2	T	C	2: 91,628,396	N523S	possibly damaging	Het
Fam186a	A	G	15: 99,939,907	Y2819H	unknown	Het
Fanca	A	T	8: 123,268,564		probably null	Het
Fezf2	T	C	14: 12,342,653	H404R	probably damaging	Het
Fry	A	G	5: 150,413,418	N1418S	probably damaging	Het
Gak	A	G	5: 108,584,295	S776P	probably benign	Het
Gbf1	A	G	19: 46,272,539	H1181R	probably damaging	Het
Gdf9	G	A	11: 53,437,098	E294K	probably benign	Het
Gje1	G	A	10: 14,716,424	R205*	probably null	Het
Gm12569	G	A	11: 51,234,786	E179K	possibly damaging	Het
Gm8206	T	C	14: 6,055,211		probably null	Het
Gpr162	T	A	6: 124,861,843		probably benign	Het
Gxylt1	C	T	15: 93,245,658	R363H	probably benign	Het
Hnrnph1	A	T	11: 50,383,899	M396L	probably benign	Het
Ice1	A	G	13: 70,589,797	V2177A	possibly damaging	Het
Ice1	T	A	13: 70,605,483	Q828L	probably damaging	Het
Il10	A	T	1: 131,021,455	T118S	probably benign	Het
Itpr2	C	T	6: 146,233,994	R1813Q	probably benign	Het
Kbtbd12	T	A	6: 88,618,548	Q100L	probably damaging	Het
Kin	A	G	2: 10,092,168	D276G	possibly damaging	Het
Klhl1	T	C	14: 96,346,943	T284A	probably damaging	Het
Kmt2d	C	T	15: 98,850,870	A2858T	unknown	Het
Krt8	G	A	15: 102,004,163	T26M	probably benign	Het
Lama3	T	A	18: 12,537,838	M827K	probably benign	Het
Lingo3	T	C	10: 80,835,763	N111S	probably damaging	Het
Megf10	GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA	GGCAGCAACAGCACCAGCAGCA	18: 57,293,999		probably benign	Het
Metap1	A	G	3: 138,466,367	V263A	probably damaging	Het
Muc5ac	A	G	7: 141,809,422	T2157A	unknown	Het
Myo1d	G	T	11: 80,601,684	H748Q	probably benign	Het
Nfkbiz	A	T	16: 55,817,839	N419K	probably benign	Het
Nol10	T	C	12: 17,362,682		probably null	Het
Nrcam	T	C	12: 44,547,322	L284P	probably damaging	Het
Obscn	A	G	11: 59,060,994	S3978P	probably benign	Het
Olfr181	T	A	16: 58,926,053	R173*	probably null	Het
Olfr968	A	T	9: 39,771,873	F309Y	probably benign	Het
Opa3	C	A	7: 19,244,971	N120K	probably benign	Het
Pabpc1l	T	C	2: 164,049,590	L576S	probably benign	Het
Panx3	A	G	9: 37,661,405	L283S	probably damaging	Het
Pcdhb4	T	A	18: 37,309,614	V659E	probably damaging	Het
Pde4dip	A	T	3: 97,699,107		probably null	Het
Pkd1l3	T	C	8: 109,672,585	V2200A	probably benign	Het
Pkp3	G	A	7: 141,082,370	M112I	probably benign	Het
Prex2	T	C	1: 11,149,854	I683T	possibly damaging	Het
Psg22	C	A	7: 18,726,759	Q438K	possibly damaging	Het
Ptgir	T	C	7: 16,906,951	V56A	possibly damaging	Het
Pus7	G	T	5: 23,760,246	T304K	probably damaging	Het
Rab38	T	C	7: 88,430,429	Y10H	possibly damaging	Het
Ros1	C	T	10: 52,046,209	G2277D	probably benign	Het
Rpain	A	T	11: 70,970,445		probably benign	Het
Shh	C	A	5: 28,458,306	S288I	probably benign	Het
Slc26a5	C	T	5: 21,834,330	V259M	possibly damaging	Het
Slc4a7	G	A	14: 14,773,348	E773K	probably benign	Het
Slit1	T	A	19: 41,629,924	N771I	probably damaging	Het
Stim1	T	A	7: 102,428,827	S179T		Het
Syk	A	G	13: 52,611,095	D86G	probably benign	Het
Tmem132b	T	G	5: 125,787,010	S727A	probably benign	Het
Trim42	T	A	9: 97,363,148	Y533F	probably benign	Het
Trpm6	A	T	19: 18,876,013	D1799V	possibly damaging	Het
Ttc26	T	A	6: 38,395,040	N188K	probably benign	Het
Ube4a	A	T	9: 44,933,436	I839N	probably damaging	Het
Ugt2b36	A	G	5: 87,080,972	I404T	probably damaging	Het
Ushbp1	T	A	8: 71,390,924	Q290L	possibly damaging	Het
Vcl	T	A	14: 20,995,046	I273K	probably damaging	Het
Vmn2r73	T	A	7: 85,871,939	I274L	probably benign	Het
Zc3h7b	A	G	15: 81,793,650	D945G	possibly damaging	Het
Zfp454	A	G	11: 50,883,753	L31P	probably damaging	Het
Zfp536	C	A	7: 37,569,692	V100L	probably damaging	Het
Zfp942	A	T	17: 21,928,837	S270R	probably benign	Het

Other mutations in Nrp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00911:Nrp1	APN	8	128476207	missense	probably benign
IGL01412:Nrp1	APN	8	128418707	splice site	probably benign
IGL01586:Nrp1	APN	8	128432032	missense	possibly damaging	0.86
IGL02307:Nrp1	APN	8	128502720	missense	probably damaging	1.00
IGL02500:Nrp1	APN	8	128425799	missense	possibly damaging	0.94
IGL02547:Nrp1	APN	8	128493031	missense	probably benign
R0046:Nrp1	UTSW	8	128500608	splice site	probably benign
R0281:Nrp1	UTSW	8	128460683	missense	probably damaging	0.96
R0403:Nrp1	UTSW	8	128457969	missense	probably damaging	1.00
R0610:Nrp1	UTSW	8	128502618	missense	probably damaging	1.00
R1055:Nrp1	UTSW	8	128468598	missense	possibly damaging	0.68
R1229:Nrp1	UTSW	8	128418716	nonsense	probably null
R1263:Nrp1	UTSW	8	128468389	missense	probably damaging	1.00
R1340:Nrp1	UTSW	8	128434355	missense	probably damaging	1.00
R1397:Nrp1	UTSW	8	128418716	nonsense	probably null
R1462:Nrp1	UTSW	8	128502798	missense	probably benign
R1462:Nrp1	UTSW	8	128502798	missense	probably benign
R1531:Nrp1	UTSW	8	128425969	missense	probably null	0.19
R1587:Nrp1	UTSW	8	128476282	missense	probably damaging	1.00
R1719:Nrp1	UTSW	8	128425885	missense	probably damaging	1.00
R1733:Nrp1	UTSW	8	128468493	missense	probably benign	0.02
R1785:Nrp1	UTSW	8	128498516	missense	probably damaging	1.00
R1786:Nrp1	UTSW	8	128498516	missense	probably damaging	1.00
R2047:Nrp1	UTSW	8	128498096	splice site	probably benign
R2130:Nrp1	UTSW	8	128498516	missense	probably damaging	1.00
R2132:Nrp1	UTSW	8	128498516	missense	probably damaging	1.00
R2133:Nrp1	UTSW	8	128498516	missense	probably damaging	1.00
R2163:Nrp1	UTSW	8	128497871	missense	probably damaging	1.00
R2338:Nrp1	UTSW	8	128497904	missense	probably benign	0.01
R2407:Nrp1	UTSW	8	128431945	missense	probably damaging	0.99
R3405:Nrp1	UTSW	8	128498088	nonsense	probably null
R3748:Nrp1	UTSW	8	128457980	missense	probably damaging	1.00
R4347:Nrp1	UTSW	8	128480991	critical splice donor site	probably null
R4379:Nrp1	UTSW	8	128468467	missense	probably damaging	1.00
R4646:Nrp1	UTSW	8	128457944	missense	probably benign	0.00
R4688:Nrp1	UTSW	8	128502566	missense	probably benign	0.01
R4916:Nrp1	UTSW	8	128502804	nonsense	probably null
R5077:Nrp1	UTSW	8	128500673	critical splice donor site	probably null
R5301:Nrp1	UTSW	8	128434197	splice site	probably null
R5509:Nrp1	UTSW	8	128425915	missense	possibly damaging	0.73
R5745:Nrp1	UTSW	8	128468448	missense	probably benign	0.22
R5873:Nrp1	UTSW	8	128468377	missense	probably damaging	1.00
R5987:Nrp1	UTSW	8	128476169	missense	probably damaging	1.00
R6060:Nrp1	UTSW	8	128497938	missense	probably damaging	1.00
R6757:Nrp1	UTSW	8	128425868	missense	probably damaging	1.00
R6889:Nrp1	UTSW	8	128493057	missense	probably damaging	1.00
R7025:Nrp1	UTSW	8	128480954	missense	probably damaging	1.00
R7065:Nrp1	UTSW	8	128460712	missense	probably benign
R7290:Nrp1	UTSW	8	128476296	critical splice donor site	probably null
R7369:Nrp1	UTSW	8	128431915	missense	probably damaging	1.00
R7553:Nrp1	UTSW	8	128431987	missense	probably damaging	1.00
R8043:Nrp1	UTSW	8	128432023	missense	probably benign	0.00
R8088:Nrp1	UTSW	8	128468516	nonsense	probably null
R8193:Nrp1	UTSW	8	128460706	missense	probably damaging	1.00
R8206:Nrp1	UTSW	8	128457957	missense	probably damaging	0.99
R8245:Nrp1	UTSW	8	128487953	missense	probably benign
R8684:Nrp1	UTSW	8	128359404	start gained	probably benign
R8734:Nrp1	UTSW	8	128480939	missense	probably benign	0.23
R8875:Nrp1	UTSW	8	128480991	critical splice donor site	probably null
R9054:Nrp1	UTSW	8	128487908	missense	probably benign
R9253:Nrp1	UTSW	8	128502663	missense	possibly damaging	0.47
R9301:Nrp1	UTSW	8	128363378	missense	probably damaging	1.00
R9437:Nrp1	UTSW	8	128460627	missense	probably benign	0.01
R9606:Nrp1	UTSW	8	128502548	missense	probably benign	0.00
R9607:Nrp1	UTSW	8	128425781	missense	probably benign	0.01
R9691:Nrp1	UTSW	8	128476169	missense	probably damaging	1.00
X0066:Nrp1	UTSW	8	128460645	missense	possibly damaging	0.95
Z1186:Nrp1	UTSW	8	128497938	missense	probably damaging	1.00
Z1189:Nrp1	UTSW	8	128497938	missense	probably damaging	1.00
Z1192:Nrp1	UTSW	8	128497938	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GACACACAGTTTTGCCTCAGC -3'
(R):5'- GTGGGATATGTCACCAACCC -3'

Sequencing Primer
(F):5'- TCAGCAGGAGATGGCAACTTCATC -3'
(R):5'- CCCAAACATTATGGAGGCAAG -3'

Posted On

2019-10-24