Incidental Mutation 'R7650:Gdf9'
ID590776
Institutional Source Beutler Lab
Gene Symbol Gdf9
Ensembl Gene ENSMUSG00000018238
Gene Namegrowth differentiation factor 9
SynonymsGdf-9
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R7650 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location53431023-53437904 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 53437098 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 294 (E294K)
Ref Sequence ENSEMBL: ENSMUSP00000018382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018382]
Predicted Effect probably benign
Transcript: ENSMUST00000018382
AA Change: E294K

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000018382
Gene: ENSMUSG00000018238
AA Change: E294K

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
TGFB 340 441 3.16e-48 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein regulates ovarian function. Female mice that are homozygous null for this gene are sterile with impaired folliculogenesis. [provided by RefSeq, Jul 2016]
PHENOTYPE: Females homozygous for a targeted null mutation are sterile with a block in folliculogenesis. Mutant oocytes exhibit perinuclear organelle aggregation, unusual Golgi complexes, absence of cortical granules, and impaired granulosa cell connections. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002J24Rik G A 7: 30,699,789 V3I probably benign Het
Adam33 T C 2: 131,061,147 E59G probably damaging Het
Akap13 T A 7: 75,643,454 V45E probably benign Het
Ap1s1 A G 5: 137,045,533 S28P probably benign Het
Btnl2 T C 17: 34,358,129 L86P probably damaging Het
Carm1 G A 9: 21,580,372 V246I probably benign Het
Cdk5rap1 C T 2: 154,354,116 D283N probably benign Het
Cfap58 C A 19: 47,986,528 N709K possibly damaging Het
Col24a1 A G 3: 145,314,453 D195G probably benign Het
Dcaf1 A G 9: 106,838,344 D220G probably benign Het
Ddias C T 7: 92,858,935 G591R probably benign Het
Defb22 A T 2: 152,486,103 I54K probably benign Het
Dennd4b G A 3: 90,268,749 W202* probably null Het
F2 T C 2: 91,628,396 N523S possibly damaging Het
Fam186a A G 15: 99,939,907 Y2819H unknown Het
Fanca A T 8: 123,268,564 probably null Het
Fezf2 T C 14: 12,342,653 H404R probably damaging Het
Fry A G 5: 150,413,418 N1418S probably damaging Het
Gak A G 5: 108,584,295 S776P probably benign Het
Gbf1 A G 19: 46,272,539 H1181R probably damaging Het
Gje1 G A 10: 14,716,424 R205* probably null Het
Gm12569 G A 11: 51,234,786 E179K possibly damaging Het
Gm8206 T C 14: 6,055,211 probably null Het
Gpr162 T A 6: 124,861,843 probably benign Het
Gxylt1 C T 15: 93,245,658 R363H probably benign Het
Hnrnph1 A T 11: 50,383,899 M396L probably benign Het
Ice1 A G 13: 70,589,797 V2177A possibly damaging Het
Ice1 T A 13: 70,605,483 Q828L probably damaging Het
Il10 A T 1: 131,021,455 T118S probably benign Het
Itpr2 C T 6: 146,233,994 R1813Q probably benign Het
Kbtbd12 T A 6: 88,618,548 Q100L probably damaging Het
Kin A G 2: 10,092,168 D276G possibly damaging Het
Klhl1 T C 14: 96,346,943 T284A probably damaging Het
Kmt2d C T 15: 98,850,870 A2858T unknown Het
Krt8 G A 15: 102,004,163 T26M probably benign Het
Lama3 T A 18: 12,537,838 M827K probably benign Het
Lingo3 T C 10: 80,835,763 N111S probably damaging Het
Megf10 GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA GGCAGCAACAGCACCAGCAGCA 18: 57,293,999 probably benign Het
Metap1 A G 3: 138,466,367 V263A probably damaging Het
Muc5ac A G 7: 141,809,422 T2157A unknown Het
Myo1d G T 11: 80,601,684 H748Q probably benign Het
Nfkbiz A T 16: 55,817,839 N419K probably benign Het
Nol10 T C 12: 17,362,682 probably null Het
Nrcam T C 12: 44,547,322 L284P probably damaging Het
Nrp1 T A 8: 128,498,014 W753R possibly damaging Het
Obscn A G 11: 59,060,994 S3978P probably benign Het
Olfr181 T A 16: 58,926,053 R173* probably null Het
Olfr968 A T 9: 39,771,873 F309Y probably benign Het
Opa3 C A 7: 19,244,971 N120K probably benign Het
Pabpc1l T C 2: 164,049,590 L576S probably benign Het
Panx3 A G 9: 37,661,405 L283S probably damaging Het
Pcdhb4 T A 18: 37,309,614 V659E probably damaging Het
Pde4dip A T 3: 97,699,107 probably null Het
Pkd1l3 T C 8: 109,672,585 V2200A probably benign Het
Pkp3 G A 7: 141,082,370 M112I probably benign Het
Prex2 T C 1: 11,149,854 I683T possibly damaging Het
Psg22 C A 7: 18,726,759 Q438K possibly damaging Het
Ptgir T C 7: 16,906,951 V56A possibly damaging Het
Pus7 G T 5: 23,760,246 T304K probably damaging Het
Rab38 T C 7: 88,430,429 Y10H possibly damaging Het
Ros1 C T 10: 52,046,209 G2277D probably benign Het
Rpain A T 11: 70,970,445 probably benign Het
Shh C A 5: 28,458,306 S288I probably benign Het
Slc26a5 C T 5: 21,834,330 V259M possibly damaging Het
Slc4a7 G A 14: 14,773,348 E773K probably benign Het
Slit1 T A 19: 41,629,924 N771I probably damaging Het
Stim1 T A 7: 102,428,827 S179T Het
Syk A G 13: 52,611,095 D86G probably benign Het
Tmem132b T G 5: 125,787,010 S727A probably benign Het
Trim42 T A 9: 97,363,148 Y533F probably benign Het
Trpm6 A T 19: 18,876,013 D1799V possibly damaging Het
Ttc26 T A 6: 38,395,040 N188K probably benign Het
Ube4a A T 9: 44,933,436 I839N probably damaging Het
Ugt2b36 A G 5: 87,080,972 I404T probably damaging Het
Ushbp1 T A 8: 71,390,924 Q290L possibly damaging Het
Vcl T A 14: 20,995,046 I273K probably damaging Het
Vmn2r73 T A 7: 85,871,939 I274L probably benign Het
Zc3h7b A G 15: 81,793,650 D945G possibly damaging Het
Zfp454 A G 11: 50,883,753 L31P probably damaging Het
Zfp536 C A 7: 37,569,692 V100L probably damaging Het
Zfp942 A T 17: 21,928,837 S270R probably benign Het
Other mutations in Gdf9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02148:Gdf9 APN 11 53436742 missense probably benign 0.02
R0688:Gdf9 UTSW 11 53436640 missense probably damaging 1.00
R1607:Gdf9 UTSW 11 53437511 missense possibly damaging 0.79
R1651:Gdf9 UTSW 11 53433749 missense probably damaging 0.98
R1902:Gdf9 UTSW 11 53436953 missense probably benign 0.26
R2128:Gdf9 UTSW 11 53437507 missense probably damaging 1.00
R5360:Gdf9 UTSW 11 53437207 missense probably benign 0.42
R5391:Gdf9 UTSW 11 53433797 missense probably benign
R5395:Gdf9 UTSW 11 53433797 missense probably benign
R5470:Gdf9 UTSW 11 53436754 missense probably benign 0.11
R5593:Gdf9 UTSW 11 53433731 missense probably damaging 0.99
R5809:Gdf9 UTSW 11 53433554 missense probably benign 0.03
R5829:Gdf9 UTSW 11 53433689 missense probably benign 0.03
R6394:Gdf9 UTSW 11 53436697 missense probably damaging 1.00
R6442:Gdf9 UTSW 11 53433688 missense probably benign 0.00
R6894:Gdf9 UTSW 11 53436819 missense possibly damaging 0.80
R7171:Gdf9 UTSW 11 53437539 missense probably damaging 1.00
Z1176:Gdf9 UTSW 11 53437525 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGCATTCACCTGTCTGTC -3'
(R):5'- GTCCCATTTGAGCTGACTAAAAC -3'

Sequencing Primer
(F):5'- TTTACATGCACAAAAGACCAGGTG -3'
(R):5'- CTCAGTCTGAAGTCATGGAGTTCAC -3'
Posted On2019-10-24