Incidental Mutation 'R7650:Myo1d'
ID 590779
Institutional Source Beutler Lab
Gene Symbol Myo1d
Ensembl Gene ENSMUSG00000035441
Gene Name myosin ID
Synonyms D11Ertd9e, 9930104H07Rik
MMRRC Submission 045727-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7650 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 80372952-80670851 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 80492510 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 748 (H748Q)
Ref Sequence ENSEMBL: ENSMUSP00000066948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041065] [ENSMUST00000070997]
AlphaFold Q5SYD0
Predicted Effect probably benign
Transcript: ENSMUST00000041065
AA Change: H748Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000037819
Gene: ENSMUSG00000035441
AA Change: H748Q

DomainStartEndE-ValueType
MYSc 3 696 N/A SMART
IQ 697 719 1.46e-3 SMART
Pfam:Myosin_TH1 803 1006 4.1e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070997
AA Change: H748Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000066948
Gene: ENSMUSG00000035441
AA Change: H748Q

DomainStartEndE-ValueType
MYSc 3 696 N/A SMART
IQ 697 719 1.46e-3 SMART
Pfam:Myosin_TH1 802 913 1.8e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (80/80)
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002J24Rik G A 7: 30,399,214 (GRCm39) V3I probably benign Het
Adam33 T C 2: 130,903,067 (GRCm39) E59G probably damaging Het
Akap13 T A 7: 75,293,202 (GRCm39) V45E probably benign Het
Ap1s1 A G 5: 137,074,387 (GRCm39) S28P probably benign Het
Btnl2 T C 17: 34,577,103 (GRCm39) L86P probably damaging Het
Carm1 G A 9: 21,491,668 (GRCm39) V246I probably benign Het
Cdk5rap1 C T 2: 154,196,036 (GRCm39) D283N probably benign Het
Cfap58 C A 19: 47,974,967 (GRCm39) N709K possibly damaging Het
Col24a1 A G 3: 145,020,214 (GRCm39) D195G probably benign Het
Dcaf1 A G 9: 106,715,543 (GRCm39) D220G probably benign Het
Ddias C T 7: 92,508,143 (GRCm39) G591R probably benign Het
Defb22 A T 2: 152,328,023 (GRCm39) I54K probably benign Het
Dennd4b G A 3: 90,176,056 (GRCm39) W202* probably null Het
F2 T C 2: 91,458,741 (GRCm39) N523S possibly damaging Het
Fam186a A G 15: 99,837,788 (GRCm39) Y2819H unknown Het
Fanca A T 8: 123,995,303 (GRCm39) probably null Het
Fezf2 T C 14: 12,342,653 (GRCm38) H404R probably damaging Het
Fry A G 5: 150,336,883 (GRCm39) N1418S probably damaging Het
Gak A G 5: 108,732,161 (GRCm39) S776P probably benign Het
Gbf1 A G 19: 46,260,978 (GRCm39) H1181R probably damaging Het
Gdf9 G A 11: 53,327,925 (GRCm39) E294K probably benign Het
Gje1 G A 10: 14,592,168 (GRCm39) R205* probably null Het
Gm8206 T C 14: 6,055,211 (GRCm38) probably null Het
Gpr162 T A 6: 124,838,806 (GRCm39) probably benign Het
Gxylt1 C T 15: 93,143,539 (GRCm39) R363H probably benign Het
Hnrnph1 A T 11: 50,274,726 (GRCm39) M396L probably benign Het
Ice1 A G 13: 70,737,916 (GRCm39) V2177A possibly damaging Het
Ice1 T A 13: 70,753,602 (GRCm39) Q828L probably damaging Het
Ift56 T A 6: 38,371,975 (GRCm39) N188K probably benign Het
Il10 A T 1: 130,949,192 (GRCm39) T118S probably benign Het
Itpr2 C T 6: 146,135,492 (GRCm39) R1813Q probably benign Het
Kbtbd12 T A 6: 88,595,530 (GRCm39) Q100L probably damaging Het
Kin A G 2: 10,096,979 (GRCm39) D276G possibly damaging Het
Klhl1 T C 14: 96,584,379 (GRCm39) T284A probably damaging Het
Kmt2d C T 15: 98,748,751 (GRCm39) A2858T unknown Het
Krt8 G A 15: 101,912,598 (GRCm39) T26M probably benign Het
Lama3 T A 18: 12,670,895 (GRCm39) M827K probably benign Het
Lingo3 T C 10: 80,671,597 (GRCm39) N111S probably damaging Het
Megf10 GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA GGCAGCAACAGCACCAGCAGCA 18: 57,427,071 (GRCm39) probably benign Het
Metap1 A G 3: 138,172,128 (GRCm39) V263A probably damaging Het
Msantd5 G A 11: 51,125,613 (GRCm39) E179K possibly damaging Het
Muc5ac A G 7: 141,363,159 (GRCm39) T2157A unknown Het
Nfkbiz A T 16: 55,638,202 (GRCm39) N419K probably benign Het
Nol10 T C 12: 17,412,683 (GRCm39) probably null Het
Nrcam T C 12: 44,594,105 (GRCm39) L284P probably damaging Het
Nrp1 T A 8: 129,224,495 (GRCm39) W753R possibly damaging Het
Obscn A G 11: 58,951,820 (GRCm39) S3978P probably benign Het
Opa3 C A 7: 18,978,896 (GRCm39) N120K probably benign Het
Or5k17 T A 16: 58,746,416 (GRCm39) R173* probably null Het
Or8g53 A T 9: 39,683,169 (GRCm39) F309Y probably benign Het
Pabpc1l T C 2: 163,891,510 (GRCm39) L576S probably benign Het
Panx3 A G 9: 37,572,701 (GRCm39) L283S probably damaging Het
Pcdhb4 T A 18: 37,442,667 (GRCm39) V659E probably damaging Het
Pde4dip A T 3: 97,606,423 (GRCm39) probably null Het
Pkd1l3 T C 8: 110,399,217 (GRCm39) V2200A probably benign Het
Pkp3 G A 7: 140,662,283 (GRCm39) M112I probably benign Het
Prex2 T C 1: 11,220,078 (GRCm39) I683T possibly damaging Het
Psg22 C A 7: 18,460,684 (GRCm39) Q438K possibly damaging Het
Ptgir T C 7: 16,640,876 (GRCm39) V56A possibly damaging Het
Pus7 G T 5: 23,965,244 (GRCm39) T304K probably damaging Het
Rab38 T C 7: 88,079,637 (GRCm39) Y10H possibly damaging Het
Ros1 C T 10: 51,922,305 (GRCm39) G2277D probably benign Het
Rpain A T 11: 70,861,271 (GRCm39) probably benign Het
Shh C A 5: 28,663,304 (GRCm39) S288I probably benign Het
Slc26a5 C T 5: 22,039,328 (GRCm39) V259M possibly damaging Het
Slc4a7 G A 14: 14,773,348 (GRCm38) E773K probably benign Het
Slit1 T A 19: 41,618,363 (GRCm39) N771I probably damaging Het
Stim1 T A 7: 102,078,034 (GRCm39) S179T Het
Syk A G 13: 52,765,131 (GRCm39) D86G probably benign Het
Tmem132b T G 5: 125,864,074 (GRCm39) S727A probably benign Het
Trim42 T A 9: 97,245,201 (GRCm39) Y533F probably benign Het
Trpm6 A T 19: 18,853,377 (GRCm39) D1799V possibly damaging Het
Ube4a A T 9: 44,844,734 (GRCm39) I839N probably damaging Het
Ugt2b36 A G 5: 87,228,831 (GRCm39) I404T probably damaging Het
Ushbp1 T A 8: 71,843,568 (GRCm39) Q290L possibly damaging Het
Vcl T A 14: 21,045,114 (GRCm39) I273K probably damaging Het
Vmn2r73 T A 7: 85,521,147 (GRCm39) I274L probably benign Het
Zc3h7b A G 15: 81,677,851 (GRCm39) D945G possibly damaging Het
Zfp454 A G 11: 50,774,580 (GRCm39) L31P probably damaging Het
Zfp536 C A 7: 37,269,117 (GRCm39) V100L probably damaging Het
Zfp942 A T 17: 22,147,818 (GRCm39) S270R probably benign Het
Other mutations in Myo1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Myo1d APN 11 80,492,566 (GRCm39) missense probably benign
IGL01087:Myo1d APN 11 80,573,261 (GRCm39) missense probably damaging 1.00
IGL01326:Myo1d APN 11 80,575,147 (GRCm39) splice site probably benign
IGL01431:Myo1d APN 11 80,565,665 (GRCm39) missense probably damaging 1.00
IGL01595:Myo1d APN 11 80,566,936 (GRCm39) missense probably benign 0.00
IGL01811:Myo1d APN 11 80,583,823 (GRCm39) missense probably damaging 0.96
IGL02301:Myo1d APN 11 80,567,679 (GRCm39) missense probably benign 0.23
IGL02388:Myo1d APN 11 80,528,823 (GRCm39) nonsense probably null
IGL02485:Myo1d APN 11 80,557,407 (GRCm39) missense probably damaging 1.00
IGL03017:Myo1d APN 11 80,492,452 (GRCm39) missense probably benign 0.26
horton UTSW 11 80,565,534 (GRCm39) missense probably damaging 1.00
multifaceted UTSW 11 80,583,898 (GRCm39) missense probably damaging 1.00
whisper UTSW 11 80,375,158 (GRCm39) missense probably damaging 0.99
whisper2 UTSW 11 80,557,404 (GRCm39) missense probably damaging 1.00
whisper3 UTSW 11 80,448,347 (GRCm39) missense probably damaging 1.00
R0069:Myo1d UTSW 11 80,528,779 (GRCm39) missense probably damaging 1.00
R0069:Myo1d UTSW 11 80,528,779 (GRCm39) missense probably damaging 1.00
R0081:Myo1d UTSW 11 80,448,349 (GRCm39) missense probably benign 0.00
R0096:Myo1d UTSW 11 80,375,158 (GRCm39) missense probably damaging 0.99
R0096:Myo1d UTSW 11 80,375,158 (GRCm39) missense probably damaging 0.99
R0244:Myo1d UTSW 11 80,565,534 (GRCm39) missense probably damaging 1.00
R0711:Myo1d UTSW 11 80,375,158 (GRCm39) missense probably damaging 0.99
R0746:Myo1d UTSW 11 80,477,705 (GRCm39) missense possibly damaging 0.94
R1084:Myo1d UTSW 11 80,575,221 (GRCm39) missense probably damaging 1.00
R1514:Myo1d UTSW 11 80,576,734 (GRCm39) missense probably damaging 0.97
R1676:Myo1d UTSW 11 80,575,247 (GRCm39) missense probably damaging 1.00
R1862:Myo1d UTSW 11 80,553,874 (GRCm39) missense probably damaging 1.00
R2497:Myo1d UTSW 11 80,565,647 (GRCm39) missense probably damaging 1.00
R2512:Myo1d UTSW 11 80,670,543 (GRCm39) missense probably benign 0.00
R3425:Myo1d UTSW 11 80,492,464 (GRCm39) missense probably benign
R3429:Myo1d UTSW 11 80,573,236 (GRCm39) missense probably damaging 1.00
R3917:Myo1d UTSW 11 80,557,404 (GRCm39) missense probably damaging 1.00
R3928:Myo1d UTSW 11 80,375,087 (GRCm39) missense probably benign 0.09
R4706:Myo1d UTSW 11 80,557,467 (GRCm39) missense probably damaging 0.96
R4723:Myo1d UTSW 11 80,670,667 (GRCm39) utr 5 prime probably benign
R4924:Myo1d UTSW 11 80,565,504 (GRCm39) missense probably damaging 1.00
R5042:Myo1d UTSW 11 80,448,347 (GRCm39) missense probably damaging 1.00
R5320:Myo1d UTSW 11 80,575,149 (GRCm39) critical splice donor site probably null
R5481:Myo1d UTSW 11 80,553,921 (GRCm39) missense possibly damaging 0.79
R6214:Myo1d UTSW 11 80,670,617 (GRCm39) start codon destroyed probably null 0.98
R6235:Myo1d UTSW 11 80,583,770 (GRCm39) missense probably benign 0.23
R6282:Myo1d UTSW 11 80,448,338 (GRCm39) missense probably damaging 0.99
R6468:Myo1d UTSW 11 80,448,300 (GRCm39) missense probably benign 0.00
R6668:Myo1d UTSW 11 80,474,701 (GRCm39) intron probably benign
R6954:Myo1d UTSW 11 80,565,783 (GRCm39) missense probably benign 0.21
R7077:Myo1d UTSW 11 80,565,460 (GRCm39) missense probably damaging 1.00
R7078:Myo1d UTSW 11 80,565,460 (GRCm39) missense probably damaging 1.00
R7080:Myo1d UTSW 11 80,565,460 (GRCm39) missense probably damaging 1.00
R7172:Myo1d UTSW 11 80,483,621 (GRCm39) missense probably benign 0.16
R7276:Myo1d UTSW 11 80,583,898 (GRCm39) missense probably damaging 1.00
R7467:Myo1d UTSW 11 80,477,743 (GRCm39) missense probably damaging 1.00
R7678:Myo1d UTSW 11 80,567,719 (GRCm39) missense possibly damaging 0.80
R7859:Myo1d UTSW 11 80,575,203 (GRCm39) missense probably damaging 1.00
R8324:Myo1d UTSW 11 80,448,347 (GRCm39) missense probably damaging 1.00
R8329:Myo1d UTSW 11 80,528,900 (GRCm39) missense probably benign 0.21
R8474:Myo1d UTSW 11 80,561,745 (GRCm39) missense possibly damaging 0.93
R8799:Myo1d UTSW 11 80,575,205 (GRCm39) missense probably damaging 1.00
R8810:Myo1d UTSW 11 80,567,758 (GRCm39) missense probably benign 0.30
R8810:Myo1d UTSW 11 80,565,758 (GRCm39) missense probably damaging 1.00
R8823:Myo1d UTSW 11 80,492,571 (GRCm39) missense possibly damaging 0.91
R9221:Myo1d UTSW 11 80,565,744 (GRCm39) missense probably damaging 1.00
R9494:Myo1d UTSW 11 80,375,093 (GRCm39) missense probably benign 0.02
R9625:Myo1d UTSW 11 80,448,296 (GRCm39) missense possibly damaging 0.95
R9626:Myo1d UTSW 11 80,448,296 (GRCm39) missense possibly damaging 0.95
R9628:Myo1d UTSW 11 80,448,296 (GRCm39) missense possibly damaging 0.95
Z1088:Myo1d UTSW 11 80,565,724 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCGTCATAACAGCAGAGAGC -3'
(R):5'- AGCCGAGGAACCATCTGAAATG -3'

Sequencing Primer
(F):5'- GAGAGCTGAGCCACTACCATG -3'
(R):5'- TGCCAAAGTCACTACTACTTAGTCAG -3'
Posted On 2019-10-24