Incidental Mutation 'R7650:Myo1d'
ID590779
Institutional Source Beutler Lab
Gene Symbol Myo1d
Ensembl Gene ENSMUSG00000035441
Gene Namemyosin ID
Synonyms9930104H07Rik, D11Ertd9e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7650 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location80482126-80780025 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 80601684 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 748 (H748Q)
Ref Sequence ENSEMBL: ENSMUSP00000066948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041065] [ENSMUST00000070997]
Predicted Effect probably benign
Transcript: ENSMUST00000041065
AA Change: H748Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000037819
Gene: ENSMUSG00000035441
AA Change: H748Q

DomainStartEndE-ValueType
MYSc 3 696 N/A SMART
IQ 697 719 1.46e-3 SMART
Pfam:Myosin_TH1 803 1006 4.1e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070997
AA Change: H748Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000066948
Gene: ENSMUSG00000035441
AA Change: H748Q

DomainStartEndE-ValueType
MYSc 3 696 N/A SMART
IQ 697 719 1.46e-3 SMART
Pfam:Myosin_TH1 802 913 1.8e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (80/80)
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002J24Rik G A 7: 30,699,789 V3I probably benign Het
Adam33 T C 2: 131,061,147 E59G probably damaging Het
Akap13 T A 7: 75,643,454 V45E probably benign Het
Ap1s1 A G 5: 137,045,533 S28P probably benign Het
Btnl2 T C 17: 34,358,129 L86P probably damaging Het
Carm1 G A 9: 21,580,372 V246I probably benign Het
Cdk5rap1 C T 2: 154,354,116 D283N probably benign Het
Cfap58 C A 19: 47,986,528 N709K possibly damaging Het
Col24a1 A G 3: 145,314,453 D195G probably benign Het
Dcaf1 A G 9: 106,838,344 D220G probably benign Het
Ddias C T 7: 92,858,935 G591R probably benign Het
Defb22 A T 2: 152,486,103 I54K probably benign Het
Dennd4b G A 3: 90,268,749 W202* probably null Het
F2 T C 2: 91,628,396 N523S possibly damaging Het
Fam186a A G 15: 99,939,907 Y2819H unknown Het
Fanca A T 8: 123,268,564 probably null Het
Fezf2 T C 14: 12,342,653 H404R probably damaging Het
Fry A G 5: 150,413,418 N1418S probably damaging Het
Gak A G 5: 108,584,295 S776P probably benign Het
Gbf1 A G 19: 46,272,539 H1181R probably damaging Het
Gdf9 G A 11: 53,437,098 E294K probably benign Het
Gje1 G A 10: 14,716,424 R205* probably null Het
Gm12569 G A 11: 51,234,786 E179K possibly damaging Het
Gm8206 T C 14: 6,055,211 probably null Het
Gpr162 T A 6: 124,861,843 probably benign Het
Gxylt1 C T 15: 93,245,658 R363H probably benign Het
Hnrnph1 A T 11: 50,383,899 M396L probably benign Het
Ice1 A G 13: 70,589,797 V2177A possibly damaging Het
Ice1 T A 13: 70,605,483 Q828L probably damaging Het
Il10 A T 1: 131,021,455 T118S probably benign Het
Itpr2 C T 6: 146,233,994 R1813Q probably benign Het
Kbtbd12 T A 6: 88,618,548 Q100L probably damaging Het
Kin A G 2: 10,092,168 D276G possibly damaging Het
Klhl1 T C 14: 96,346,943 T284A probably damaging Het
Kmt2d C T 15: 98,850,870 A2858T unknown Het
Krt8 G A 15: 102,004,163 T26M probably benign Het
Lama3 T A 18: 12,537,838 M827K probably benign Het
Lingo3 T C 10: 80,835,763 N111S probably damaging Het
Megf10 GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA GGCAGCAACAGCACCAGCAGCA 18: 57,293,999 probably benign Het
Metap1 A G 3: 138,466,367 V263A probably damaging Het
Muc5ac A G 7: 141,809,422 T2157A unknown Het
Nfkbiz A T 16: 55,817,839 N419K probably benign Het
Nol10 T C 12: 17,362,682 probably null Het
Nrcam T C 12: 44,547,322 L284P probably damaging Het
Nrp1 T A 8: 128,498,014 W753R possibly damaging Het
Obscn A G 11: 59,060,994 S3978P probably benign Het
Olfr181 T A 16: 58,926,053 R173* probably null Het
Olfr968 A T 9: 39,771,873 F309Y probably benign Het
Opa3 C A 7: 19,244,971 N120K probably benign Het
Pabpc1l T C 2: 164,049,590 L576S probably benign Het
Panx3 A G 9: 37,661,405 L283S probably damaging Het
Pcdhb4 T A 18: 37,309,614 V659E probably damaging Het
Pde4dip A T 3: 97,699,107 probably null Het
Pkd1l3 T C 8: 109,672,585 V2200A probably benign Het
Pkp3 G A 7: 141,082,370 M112I probably benign Het
Prex2 T C 1: 11,149,854 I683T possibly damaging Het
Psg22 C A 7: 18,726,759 Q438K possibly damaging Het
Ptgir T C 7: 16,906,951 V56A possibly damaging Het
Pus7 G T 5: 23,760,246 T304K probably damaging Het
Rab38 T C 7: 88,430,429 Y10H possibly damaging Het
Ros1 C T 10: 52,046,209 G2277D probably benign Het
Rpain A T 11: 70,970,445 probably benign Het
Shh C A 5: 28,458,306 S288I probably benign Het
Slc26a5 C T 5: 21,834,330 V259M possibly damaging Het
Slc4a7 G A 14: 14,773,348 E773K probably benign Het
Slit1 T A 19: 41,629,924 N771I probably damaging Het
Stim1 T A 7: 102,428,827 S179T Het
Syk A G 13: 52,611,095 D86G probably benign Het
Tmem132b T G 5: 125,787,010 S727A probably benign Het
Trim42 T A 9: 97,363,148 Y533F probably benign Het
Trpm6 A T 19: 18,876,013 D1799V possibly damaging Het
Ttc26 T A 6: 38,395,040 N188K probably benign Het
Ube4a A T 9: 44,933,436 I839N probably damaging Het
Ugt2b36 A G 5: 87,080,972 I404T probably damaging Het
Ushbp1 T A 8: 71,390,924 Q290L possibly damaging Het
Vcl T A 14: 20,995,046 I273K probably damaging Het
Vmn2r73 T A 7: 85,871,939 I274L probably benign Het
Zc3h7b A G 15: 81,793,650 D945G possibly damaging Het
Zfp454 A G 11: 50,883,753 L31P probably damaging Het
Zfp536 C A 7: 37,569,692 V100L probably damaging Het
Zfp942 A T 17: 21,928,837 S270R probably benign Het
Other mutations in Myo1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Myo1d APN 11 80601740 missense probably benign
IGL01087:Myo1d APN 11 80682435 missense probably damaging 1.00
IGL01326:Myo1d APN 11 80684321 splice site probably benign
IGL01431:Myo1d APN 11 80674839 missense probably damaging 1.00
IGL01595:Myo1d APN 11 80676110 missense probably benign 0.00
IGL01811:Myo1d APN 11 80692997 missense probably damaging 0.96
IGL02301:Myo1d APN 11 80676853 missense probably benign 0.23
IGL02388:Myo1d APN 11 80637997 nonsense probably null
IGL02485:Myo1d APN 11 80666581 missense probably damaging 1.00
IGL03017:Myo1d APN 11 80601626 missense probably benign 0.26
horton UTSW 11 80674708 missense probably damaging 1.00
multifaceted UTSW 11 80693072 missense probably damaging 1.00
whisper UTSW 11 80484332 missense probably damaging 0.99
whisper2 UTSW 11 80666578 missense probably damaging 1.00
whisper3 UTSW 11 80557521 missense probably damaging 1.00
R0069:Myo1d UTSW 11 80637953 missense probably damaging 1.00
R0069:Myo1d UTSW 11 80637953 missense probably damaging 1.00
R0081:Myo1d UTSW 11 80557523 missense probably benign 0.00
R0096:Myo1d UTSW 11 80484332 missense probably damaging 0.99
R0096:Myo1d UTSW 11 80484332 missense probably damaging 0.99
R0244:Myo1d UTSW 11 80674708 missense probably damaging 1.00
R0711:Myo1d UTSW 11 80484332 missense probably damaging 0.99
R0746:Myo1d UTSW 11 80586879 missense possibly damaging 0.94
R1084:Myo1d UTSW 11 80684395 missense probably damaging 1.00
R1514:Myo1d UTSW 11 80685908 missense probably damaging 0.97
R1676:Myo1d UTSW 11 80684421 missense probably damaging 1.00
R1862:Myo1d UTSW 11 80663048 missense probably damaging 1.00
R2497:Myo1d UTSW 11 80674821 missense probably damaging 1.00
R2512:Myo1d UTSW 11 80779717 missense probably benign 0.00
R3425:Myo1d UTSW 11 80601638 missense probably benign
R3429:Myo1d UTSW 11 80682410 missense probably damaging 1.00
R3917:Myo1d UTSW 11 80666578 missense probably damaging 1.00
R3928:Myo1d UTSW 11 80484261 missense probably benign 0.09
R4706:Myo1d UTSW 11 80666641 missense probably damaging 0.96
R4723:Myo1d UTSW 11 80779841 utr 5 prime probably benign
R4924:Myo1d UTSW 11 80674678 missense probably damaging 1.00
R5042:Myo1d UTSW 11 80557521 missense probably damaging 1.00
R5320:Myo1d UTSW 11 80684323 critical splice donor site probably null
R5481:Myo1d UTSW 11 80663095 missense possibly damaging 0.79
R6214:Myo1d UTSW 11 80779791 start codon destroyed probably null 0.98
R6235:Myo1d UTSW 11 80692944 missense probably benign 0.23
R6282:Myo1d UTSW 11 80557512 missense probably damaging 0.99
R6468:Myo1d UTSW 11 80557474 missense probably benign 0.00
R6668:Myo1d UTSW 11 80583875 intron probably benign
R6954:Myo1d UTSW 11 80674957 missense probably benign 0.21
R7077:Myo1d UTSW 11 80674634 missense probably damaging 1.00
R7078:Myo1d UTSW 11 80674634 missense probably damaging 1.00
R7080:Myo1d UTSW 11 80674634 missense probably damaging 1.00
R7172:Myo1d UTSW 11 80592795 missense probably benign 0.16
R7276:Myo1d UTSW 11 80693072 missense probably damaging 1.00
R7467:Myo1d UTSW 11 80586917 missense probably damaging 1.00
R7678:Myo1d UTSW 11 80676893 missense possibly damaging 0.80
R7859:Myo1d UTSW 11 80684377 missense probably damaging 1.00
R8324:Myo1d UTSW 11 80557521 missense probably damaging 1.00
R8329:Myo1d UTSW 11 80638074 missense probably benign 0.21
Z1088:Myo1d UTSW 11 80674898 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCGTCATAACAGCAGAGAGC -3'
(R):5'- AGCCGAGGAACCATCTGAAATG -3'

Sequencing Primer
(F):5'- GAGAGCTGAGCCACTACCATG -3'
(R):5'- TGCCAAAGTCACTACTACTTAGTCAG -3'
Posted On2019-10-24