Incidental Mutation 'R7650:Syk'
ID590782
Institutional Source Beutler Lab
Gene Symbol Syk
Ensembl Gene ENSMUSG00000021457
Gene Namespleen tyrosine kinase
SynonymsSykb
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7650 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location52583173-52648792 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 52611095 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 86 (D86G)
Ref Sequence ENSEMBL: ENSMUSP00000060828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055087] [ENSMUST00000118756] [ENSMUST00000120135]
Predicted Effect probably benign
Transcript: ENSMUST00000055087
AA Change: D86G

PolyPhen 2 Score 0.241 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000060828
Gene: ENSMUSG00000021457
AA Change: D86G

DomainStartEndE-ValueType
SH2 12 97 4.51e-26 SMART
SH2 165 249 5.06e-29 SMART
TyrKc 365 620 7.61e-120 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118756
AA Change: D86G

PolyPhen 2 Score 0.430 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112914
Gene: ENSMUSG00000021457
AA Change: D86G

DomainStartEndE-ValueType
SH2 12 97 4.51e-26 SMART
SH2 165 249 5.06e-29 SMART
TyrKc 342 582 2.68e-106 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120135
AA Change: D86G

PolyPhen 2 Score 0.241 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000113852
Gene: ENSMUSG00000021457
AA Change: D86G

DomainStartEndE-ValueType
SH2 12 97 4.51e-26 SMART
SH2 165 249 5.06e-29 SMART
TyrKc 365 620 7.61e-120 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of non-receptor type Tyr protein kinases. This protein is widely expressed in hematopoietic cells and is involved in coupling activated immunoreceptors to downstream signaling events that mediate diverse cellular responses, including proliferation, differentiation, and phagocytosis. It is thought to be a modulator of epithelial cell growth and a potential tumour suppressor in human breast carcinomas. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygous null mice have high rates of postnatal lethality, exhibit developmental defects of B cells, T cells and osteoclasts, and have defective dendritic cell cross-presentation of antigens from necrotic cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002J24Rik G A 7: 30,699,789 V3I probably benign Het
Adam33 T C 2: 131,061,147 E59G probably damaging Het
Akap13 T A 7: 75,643,454 V45E probably benign Het
Ap1s1 A G 5: 137,045,533 S28P probably benign Het
Btnl2 T C 17: 34,358,129 L86P probably damaging Het
Carm1 G A 9: 21,580,372 V246I probably benign Het
Cdk5rap1 C T 2: 154,354,116 D283N probably benign Het
Cfap58 C A 19: 47,986,528 N709K possibly damaging Het
Col24a1 A G 3: 145,314,453 D195G probably benign Het
Dcaf1 A G 9: 106,838,344 D220G probably benign Het
Ddias C T 7: 92,858,935 G591R probably benign Het
Defb22 A T 2: 152,486,103 I54K probably benign Het
Dennd4b G A 3: 90,268,749 W202* probably null Het
F2 T C 2: 91,628,396 N523S possibly damaging Het
Fam186a A G 15: 99,939,907 Y2819H unknown Het
Fanca A T 8: 123,268,564 probably null Het
Fezf2 T C 14: 12,342,653 H404R probably damaging Het
Fry A G 5: 150,413,418 N1418S probably damaging Het
Gak A G 5: 108,584,295 S776P probably benign Het
Gbf1 A G 19: 46,272,539 H1181R probably damaging Het
Gdf9 G A 11: 53,437,098 E294K probably benign Het
Gje1 G A 10: 14,716,424 R205* probably null Het
Gm12569 G A 11: 51,234,786 E179K possibly damaging Het
Gm8206 T C 14: 6,055,211 probably null Het
Gpr162 T A 6: 124,861,843 probably benign Het
Gxylt1 C T 15: 93,245,658 R363H probably benign Het
Hnrnph1 A T 11: 50,383,899 M396L probably benign Het
Ice1 A G 13: 70,589,797 V2177A possibly damaging Het
Ice1 T A 13: 70,605,483 Q828L probably damaging Het
Il10 A T 1: 131,021,455 T118S probably benign Het
Itpr2 C T 6: 146,233,994 R1813Q probably benign Het
Kbtbd12 T A 6: 88,618,548 Q100L probably damaging Het
Kin A G 2: 10,092,168 D276G possibly damaging Het
Klhl1 T C 14: 96,346,943 T284A probably damaging Het
Kmt2d C T 15: 98,850,870 A2858T unknown Het
Krt8 G A 15: 102,004,163 T26M probably benign Het
Lama3 T A 18: 12,537,838 M827K probably benign Het
Lingo3 T C 10: 80,835,763 N111S probably damaging Het
Megf10 GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA GGCAGCAACAGCACCAGCAGCA 18: 57,293,999 probably benign Het
Metap1 A G 3: 138,466,367 V263A probably damaging Het
Muc5ac A G 7: 141,809,422 T2157A unknown Het
Myo1d G T 11: 80,601,684 H748Q probably benign Het
Nfkbiz A T 16: 55,817,839 N419K probably benign Het
Nol10 T C 12: 17,362,682 probably null Het
Nrcam T C 12: 44,547,322 L284P probably damaging Het
Nrp1 T A 8: 128,498,014 W753R possibly damaging Het
Obscn A G 11: 59,060,994 S3978P probably benign Het
Olfr181 T A 16: 58,926,053 R173* probably null Het
Olfr968 A T 9: 39,771,873 F309Y probably benign Het
Opa3 C A 7: 19,244,971 N120K probably benign Het
Pabpc1l T C 2: 164,049,590 L576S probably benign Het
Panx3 A G 9: 37,661,405 L283S probably damaging Het
Pcdhb4 T A 18: 37,309,614 V659E probably damaging Het
Pde4dip A T 3: 97,699,107 probably null Het
Pkd1l3 T C 8: 109,672,585 V2200A probably benign Het
Pkp3 G A 7: 141,082,370 M112I probably benign Het
Prex2 T C 1: 11,149,854 I683T possibly damaging Het
Psg22 C A 7: 18,726,759 Q438K possibly damaging Het
Ptgir T C 7: 16,906,951 V56A possibly damaging Het
Pus7 G T 5: 23,760,246 T304K probably damaging Het
Rab38 T C 7: 88,430,429 Y10H possibly damaging Het
Ros1 C T 10: 52,046,209 G2277D probably benign Het
Rpain A T 11: 70,970,445 probably benign Het
Shh C A 5: 28,458,306 S288I probably benign Het
Slc26a5 C T 5: 21,834,330 V259M possibly damaging Het
Slc4a7 G A 14: 14,773,348 E773K probably benign Het
Slit1 T A 19: 41,629,924 N771I probably damaging Het
Stim1 T A 7: 102,428,827 S179T Het
Tmem132b T G 5: 125,787,010 S727A probably benign Het
Trim42 T A 9: 97,363,148 Y533F probably benign Het
Trpm6 A T 19: 18,876,013 D1799V possibly damaging Het
Ttc26 T A 6: 38,395,040 N188K probably benign Het
Ube4a A T 9: 44,933,436 I839N probably damaging Het
Ugt2b36 A G 5: 87,080,972 I404T probably damaging Het
Ushbp1 T A 8: 71,390,924 Q290L possibly damaging Het
Vcl T A 14: 20,995,046 I273K probably damaging Het
Vmn2r73 T A 7: 85,871,939 I274L probably benign Het
Zc3h7b A G 15: 81,793,650 D945G possibly damaging Het
Zfp454 A G 11: 50,883,753 L31P probably damaging Het
Zfp536 C A 7: 37,569,692 V100L probably damaging Het
Zfp942 A T 17: 21,928,837 S270R probably benign Het
Other mutations in Syk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01478:Syk APN 13 52624748 missense probably benign 0.00
IGL01522:Syk APN 13 52643061 missense probably benign
IGL01957:Syk APN 13 52631740 missense probably benign
IGL01962:Syk APN 13 52610957 missense probably damaging 1.00
IGL02613:Syk APN 13 52643040 missense probably damaging 0.97
IGL02824:Syk APN 13 52623283 splice site probably benign
IGL03130:Syk APN 13 52622732 missense probably benign 0.12
Apricot UTSW 13 52640733 missense probably damaging 1.00
Poppy UTSW 13 52640733 missense probably damaging 1.00
Sisyphus UTSW 13 52640790 missense probably damaging 1.00
H8562:Syk UTSW 13 52640621 missense probably damaging 1.00
R0091:Syk UTSW 13 52640733 missense probably damaging 1.00
R0346:Syk UTSW 13 52640659 missense probably damaging 1.00
R1888:Syk UTSW 13 52640790 missense probably damaging 1.00
R1888:Syk UTSW 13 52640790 missense probably damaging 1.00
R1917:Syk UTSW 13 52622708 missense probably damaging 1.00
R2001:Syk UTSW 13 52611238 missense probably benign 0.21
R2919:Syk UTSW 13 52611121 missense probably benign
R3413:Syk UTSW 13 52631739 missense probably benign
R3695:Syk UTSW 13 52622765 splice site probably null
R4363:Syk UTSW 13 52640730 missense probably damaging 1.00
R4754:Syk UTSW 13 52612259 intron probably benign
R4755:Syk UTSW 13 52641986 missense probably benign 0.25
R4806:Syk UTSW 13 52632927 missense probably benign 0.14
R4817:Syk UTSW 13 52611206 missense probably benign 0.03
R4903:Syk UTSW 13 52611081 missense probably damaging 1.00
R4997:Syk UTSW 13 52612448 nonsense probably null
R5066:Syk UTSW 13 52641982 missense possibly damaging 0.49
R5114:Syk UTSW 13 52611035 missense probably damaging 1.00
R5267:Syk UTSW 13 52641926 missense probably benign 0.05
R5323:Syk UTSW 13 52631717 missense probably benign 0.00
R5705:Syk UTSW 13 52611047 missense probably benign 0.03
R6190:Syk UTSW 13 52611053 missense probably damaging 0.97
R6892:Syk UTSW 13 52632898 missense probably benign 0.00
R6932:Syk UTSW 13 52612459 splice site probably null
R6977:Syk UTSW 13 52633058 missense probably benign 0.00
R7496:Syk UTSW 13 52612416 missense probably benign
R8081:Syk UTSW 13 52638159 missense probably benign 0.00
R8199:Syk UTSW 13 52624732 missense probably benign 0.00
R8350:Syk UTSW 13 52620899 missense probably damaging 1.00
R8381:Syk UTSW 13 52633049 missense probably benign 0.08
R8420:Syk UTSW 13 52624727 missense probably benign 0.02
R8450:Syk UTSW 13 52620899 missense probably damaging 1.00
Z1177:Syk UTSW 13 52632913 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AGAGGCTGAAGACTACCTGGTC -3'
(R):5'- GCACAGGCTCTGAATATGTTTAG -3'

Sequencing Primer
(F):5'- TGGTCCAGGGAGGCATGAC -3'
(R):5'- TTAGAGAACTCTGTGGGCTCAAGC -3'
Posted On2019-10-24