Incidental Mutation 'R7650:Kmt2d'
ID 590791
Institutional Source Beutler Lab
Gene Symbol Kmt2d
Ensembl Gene ENSMUSG00000048154
Gene Name lysine (K)-specific methyltransferase 2D
Synonyms Mll4, Mll2, C430014K11Rik
MMRRC Submission 045727-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7650 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 98729550-98769085 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 98748751 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 2858 (A2858T)
Ref Sequence ENSEMBL: ENSMUSP00000023741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023741] [ENSMUST00000178486] [ENSMUST00000184363]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000023741
AA Change: A2858T
SMART Domains Protein: ENSMUSP00000023741
Gene: ENSMUSG00000048154
AA Change: A2858T

DomainStartEndE-ValueType
low complexity region 135 145 N/A INTRINSIC
PHD 171 218 1.65e-5 SMART
RING 172 217 2.01e0 SMART
PHD 228 274 2.13e-8 SMART
RING 229 273 2.11e-3 SMART
PHD 275 321 1.57e-11 SMART
RING 276 320 2.36e0 SMART
low complexity region 430 489 N/A INTRINSIC
low complexity region 500 562 N/A INTRINSIC
low complexity region 564 613 N/A INTRINSIC
low complexity region 619 717 N/A INTRINSIC
internal_repeat_3 719 768 2.82e-8 PROSPERO
internal_repeat_3 773 822 2.82e-8 PROSPERO
low complexity region 826 842 N/A INTRINSIC
low complexity region 844 919 N/A INTRINSIC
low complexity region 958 981 N/A INTRINSIC
low complexity region 985 1023 N/A INTRINSIC
low complexity region 1069 1076 N/A INTRINSIC
low complexity region 1139 1153 N/A INTRINSIC
low complexity region 1259 1285 N/A INTRINSIC
low complexity region 1307 1314 N/A INTRINSIC
PHD 1335 1384 7.01e-9 SMART
RING 1336 1383 1.46e1 SMART
PHD 1385 1431 8.56e-13 SMART
PHD 1462 1513 1.11e-6 SMART
RING 1463 1512 1.46e1 SMART
low complexity region 1514 1538 N/A INTRINSIC
low complexity region 1567 1576 N/A INTRINSIC
low complexity region 1589 1612 N/A INTRINSIC
low complexity region 1634 1646 N/A INTRINSIC
low complexity region 1707 1719 N/A INTRINSIC
low complexity region 1883 1896 N/A INTRINSIC
low complexity region 1931 1950 N/A INTRINSIC
HMG 1969 2037 6.35e-6 SMART
low complexity region 2064 2079 N/A INTRINSIC
low complexity region 2147 2167 N/A INTRINSIC
low complexity region 2170 2181 N/A INTRINSIC
low complexity region 2306 2323 N/A INTRINSIC
low complexity region 2334 2359 N/A INTRINSIC
low complexity region 2366 2388 N/A INTRINSIC
low complexity region 2402 2419 N/A INTRINSIC
low complexity region 2546 2559 N/A INTRINSIC
low complexity region 2610 2622 N/A INTRINSIC
coiled coil region 2632 2665 N/A INTRINSIC
coiled coil region 2768 2813 N/A INTRINSIC
low complexity region 2855 2868 N/A INTRINSIC
low complexity region 2887 2899 N/A INTRINSIC
low complexity region 3151 3165 N/A INTRINSIC
low complexity region 3189 3204 N/A INTRINSIC
low complexity region 3241 3263 N/A INTRINSIC
low complexity region 3390 3400 N/A INTRINSIC
low complexity region 3629 3659 N/A INTRINSIC
coiled coil region 3712 3749 N/A INTRINSIC
low complexity region 3781 3801 N/A INTRINSIC
coiled coil region 3910 4003 N/A INTRINSIC
low complexity region 4128 4159 N/A INTRINSIC
low complexity region 4167 4183 N/A INTRINSIC
low complexity region 4226 4246 N/A INTRINSIC
low complexity region 4266 4293 N/A INTRINSIC
low complexity region 4306 4322 N/A INTRINSIC
low complexity region 4361 4378 N/A INTRINSIC
coiled coil region 4591 4613 N/A INTRINSIC
low complexity region 4661 4684 N/A INTRINSIC
low complexity region 4745 4755 N/A INTRINSIC
low complexity region 4877 4896 N/A INTRINSIC
low complexity region 4957 4983 N/A INTRINSIC
low complexity region 4989 5029 N/A INTRINSIC
low complexity region 5100 5107 N/A INTRINSIC
PHD 5142 5188 4.67e-5 SMART
RING 5143 5187 4.87e0 SMART
FYRN 5242 5285 5.07e-21 SMART
FYRC 5291 5378 2.51e-43 SMART
SET 5448 5570 5.69e-36 SMART
PostSET 5572 5588 3.58e-5 SMART
Predicted Effect unknown
Transcript: ENSMUST00000178486
AA Change: A2858T
SMART Domains Protein: ENSMUSP00000135941
Gene: ENSMUSG00000048154
AA Change: A2858T

DomainStartEndE-ValueType
low complexity region 135 145 N/A INTRINSIC
PHD 171 218 1.65e-5 SMART
RING 172 217 2.01e0 SMART
PHD 228 274 2.13e-8 SMART
RING 229 273 2.11e-3 SMART
PHD 275 321 1.57e-11 SMART
RING 276 320 2.36e0 SMART
low complexity region 430 489 N/A INTRINSIC
low complexity region 500 562 N/A INTRINSIC
low complexity region 564 613 N/A INTRINSIC
low complexity region 619 717 N/A INTRINSIC
internal_repeat_3 719 768 2.82e-8 PROSPERO
internal_repeat_3 773 822 2.82e-8 PROSPERO
low complexity region 826 842 N/A INTRINSIC
low complexity region 844 919 N/A INTRINSIC
low complexity region 958 981 N/A INTRINSIC
low complexity region 985 1023 N/A INTRINSIC
low complexity region 1069 1076 N/A INTRINSIC
low complexity region 1139 1153 N/A INTRINSIC
low complexity region 1259 1285 N/A INTRINSIC
low complexity region 1307 1314 N/A INTRINSIC
PHD 1335 1384 7.01e-9 SMART
RING 1336 1383 1.46e1 SMART
PHD 1385 1431 8.56e-13 SMART
PHD 1462 1513 1.11e-6 SMART
RING 1463 1512 1.46e1 SMART
low complexity region 1514 1538 N/A INTRINSIC
low complexity region 1567 1576 N/A INTRINSIC
low complexity region 1589 1612 N/A INTRINSIC
low complexity region 1634 1646 N/A INTRINSIC
low complexity region 1707 1719 N/A INTRINSIC
low complexity region 1883 1896 N/A INTRINSIC
low complexity region 1931 1950 N/A INTRINSIC
HMG 1969 2037 6.35e-6 SMART
low complexity region 2064 2079 N/A INTRINSIC
low complexity region 2147 2167 N/A INTRINSIC
low complexity region 2170 2181 N/A INTRINSIC
low complexity region 2306 2323 N/A INTRINSIC
low complexity region 2334 2359 N/A INTRINSIC
low complexity region 2366 2388 N/A INTRINSIC
low complexity region 2402 2419 N/A INTRINSIC
low complexity region 2546 2559 N/A INTRINSIC
low complexity region 2610 2622 N/A INTRINSIC
coiled coil region 2632 2665 N/A INTRINSIC
coiled coil region 2768 2813 N/A INTRINSIC
low complexity region 2855 2868 N/A INTRINSIC
low complexity region 2887 2899 N/A INTRINSIC
low complexity region 3151 3165 N/A INTRINSIC
low complexity region 3189 3204 N/A INTRINSIC
low complexity region 3241 3263 N/A INTRINSIC
low complexity region 3390 3400 N/A INTRINSIC
low complexity region 3629 3659 N/A INTRINSIC
coiled coil region 3712 3749 N/A INTRINSIC
low complexity region 3781 3801 N/A INTRINSIC
coiled coil region 3910 4003 N/A INTRINSIC
low complexity region 4128 4159 N/A INTRINSIC
low complexity region 4167 4183 N/A INTRINSIC
low complexity region 4226 4246 N/A INTRINSIC
low complexity region 4266 4293 N/A INTRINSIC
low complexity region 4306 4322 N/A INTRINSIC
low complexity region 4361 4378 N/A INTRINSIC
coiled coil region 4591 4613 N/A INTRINSIC
low complexity region 4661 4684 N/A INTRINSIC
low complexity region 4745 4755 N/A INTRINSIC
low complexity region 4877 4896 N/A INTRINSIC
low complexity region 4957 4983 N/A INTRINSIC
low complexity region 4989 5029 N/A INTRINSIC
low complexity region 5100 5107 N/A INTRINSIC
PHD 5142 5188 4.67e-5 SMART
RING 5143 5187 4.87e0 SMART
FYRN 5242 5285 5.07e-21 SMART
FYRC 5291 5378 2.51e-43 SMART
SET 5448 5570 5.69e-36 SMART
PostSET 5572 5588 3.58e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184363
SMART Domains Protein: ENSMUSP00000139020
Gene: ENSMUSG00000048154

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229651
Meta Mutation Damage Score 0.0852 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a histone methyltransferase that methylates the Lys-4 position of histone H3. The encoded protein is part of a large protein complex called ASCOM, which has been shown to be a transcriptional regulator of the beta-globin and estrogen receptor genes. Mutations in this gene have been shown to be a cause of Kabuki syndrome. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic lethality around E9.5. Mice homozygous for a conditional allele activated in different cell-types exhibit impaired adipogenesis, impaired myogenesis, perturbed germinal B cell development and promoteion of lymphomagenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002J24Rik G A 7: 30,399,214 (GRCm39) V3I probably benign Het
Adam33 T C 2: 130,903,067 (GRCm39) E59G probably damaging Het
Akap13 T A 7: 75,293,202 (GRCm39) V45E probably benign Het
Ap1s1 A G 5: 137,074,387 (GRCm39) S28P probably benign Het
Btnl2 T C 17: 34,577,103 (GRCm39) L86P probably damaging Het
Carm1 G A 9: 21,491,668 (GRCm39) V246I probably benign Het
Cdk5rap1 C T 2: 154,196,036 (GRCm39) D283N probably benign Het
Cfap58 C A 19: 47,974,967 (GRCm39) N709K possibly damaging Het
Col24a1 A G 3: 145,020,214 (GRCm39) D195G probably benign Het
Dcaf1 A G 9: 106,715,543 (GRCm39) D220G probably benign Het
Ddias C T 7: 92,508,143 (GRCm39) G591R probably benign Het
Defb22 A T 2: 152,328,023 (GRCm39) I54K probably benign Het
Dennd4b G A 3: 90,176,056 (GRCm39) W202* probably null Het
F2 T C 2: 91,458,741 (GRCm39) N523S possibly damaging Het
Fam186a A G 15: 99,837,788 (GRCm39) Y2819H unknown Het
Fanca A T 8: 123,995,303 (GRCm39) probably null Het
Fezf2 T C 14: 12,342,653 (GRCm38) H404R probably damaging Het
Fry A G 5: 150,336,883 (GRCm39) N1418S probably damaging Het
Gak A G 5: 108,732,161 (GRCm39) S776P probably benign Het
Gbf1 A G 19: 46,260,978 (GRCm39) H1181R probably damaging Het
Gdf9 G A 11: 53,327,925 (GRCm39) E294K probably benign Het
Gje1 G A 10: 14,592,168 (GRCm39) R205* probably null Het
Gm8206 T C 14: 6,055,211 (GRCm38) probably null Het
Gpr162 T A 6: 124,838,806 (GRCm39) probably benign Het
Gxylt1 C T 15: 93,143,539 (GRCm39) R363H probably benign Het
Hnrnph1 A T 11: 50,274,726 (GRCm39) M396L probably benign Het
Ice1 A G 13: 70,737,916 (GRCm39) V2177A possibly damaging Het
Ice1 T A 13: 70,753,602 (GRCm39) Q828L probably damaging Het
Ift56 T A 6: 38,371,975 (GRCm39) N188K probably benign Het
Il10 A T 1: 130,949,192 (GRCm39) T118S probably benign Het
Itpr2 C T 6: 146,135,492 (GRCm39) R1813Q probably benign Het
Kbtbd12 T A 6: 88,595,530 (GRCm39) Q100L probably damaging Het
Kin A G 2: 10,096,979 (GRCm39) D276G possibly damaging Het
Klhl1 T C 14: 96,584,379 (GRCm39) T284A probably damaging Het
Krt8 G A 15: 101,912,598 (GRCm39) T26M probably benign Het
Lama3 T A 18: 12,670,895 (GRCm39) M827K probably benign Het
Lingo3 T C 10: 80,671,597 (GRCm39) N111S probably damaging Het
Megf10 GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA GGCAGCAACAGCACCAGCAGCA 18: 57,427,071 (GRCm39) probably benign Het
Metap1 A G 3: 138,172,128 (GRCm39) V263A probably damaging Het
Msantd5 G A 11: 51,125,613 (GRCm39) E179K possibly damaging Het
Muc5ac A G 7: 141,363,159 (GRCm39) T2157A unknown Het
Myo1d G T 11: 80,492,510 (GRCm39) H748Q probably benign Het
Nfkbiz A T 16: 55,638,202 (GRCm39) N419K probably benign Het
Nol10 T C 12: 17,412,683 (GRCm39) probably null Het
Nrcam T C 12: 44,594,105 (GRCm39) L284P probably damaging Het
Nrp1 T A 8: 129,224,495 (GRCm39) W753R possibly damaging Het
Obscn A G 11: 58,951,820 (GRCm39) S3978P probably benign Het
Opa3 C A 7: 18,978,896 (GRCm39) N120K probably benign Het
Or5k17 T A 16: 58,746,416 (GRCm39) R173* probably null Het
Or8g53 A T 9: 39,683,169 (GRCm39) F309Y probably benign Het
Pabpc1l T C 2: 163,891,510 (GRCm39) L576S probably benign Het
Panx3 A G 9: 37,572,701 (GRCm39) L283S probably damaging Het
Pcdhb4 T A 18: 37,442,667 (GRCm39) V659E probably damaging Het
Pde4dip A T 3: 97,606,423 (GRCm39) probably null Het
Pkd1l3 T C 8: 110,399,217 (GRCm39) V2200A probably benign Het
Pkp3 G A 7: 140,662,283 (GRCm39) M112I probably benign Het
Prex2 T C 1: 11,220,078 (GRCm39) I683T possibly damaging Het
Psg22 C A 7: 18,460,684 (GRCm39) Q438K possibly damaging Het
Ptgir T C 7: 16,640,876 (GRCm39) V56A possibly damaging Het
Pus7 G T 5: 23,965,244 (GRCm39) T304K probably damaging Het
Rab38 T C 7: 88,079,637 (GRCm39) Y10H possibly damaging Het
Ros1 C T 10: 51,922,305 (GRCm39) G2277D probably benign Het
Rpain A T 11: 70,861,271 (GRCm39) probably benign Het
Shh C A 5: 28,663,304 (GRCm39) S288I probably benign Het
Slc26a5 C T 5: 22,039,328 (GRCm39) V259M possibly damaging Het
Slc4a7 G A 14: 14,773,348 (GRCm38) E773K probably benign Het
Slit1 T A 19: 41,618,363 (GRCm39) N771I probably damaging Het
Stim1 T A 7: 102,078,034 (GRCm39) S179T Het
Syk A G 13: 52,765,131 (GRCm39) D86G probably benign Het
Tmem132b T G 5: 125,864,074 (GRCm39) S727A probably benign Het
Trim42 T A 9: 97,245,201 (GRCm39) Y533F probably benign Het
Trpm6 A T 19: 18,853,377 (GRCm39) D1799V possibly damaging Het
Ube4a A T 9: 44,844,734 (GRCm39) I839N probably damaging Het
Ugt2b36 A G 5: 87,228,831 (GRCm39) I404T probably damaging Het
Ushbp1 T A 8: 71,843,568 (GRCm39) Q290L possibly damaging Het
Vcl T A 14: 21,045,114 (GRCm39) I273K probably damaging Het
Vmn2r73 T A 7: 85,521,147 (GRCm39) I274L probably benign Het
Zc3h7b A G 15: 81,677,851 (GRCm39) D945G possibly damaging Het
Zfp454 A G 11: 50,774,580 (GRCm39) L31P probably damaging Het
Zfp536 C A 7: 37,269,117 (GRCm39) V100L probably damaging Het
Zfp942 A T 17: 22,147,818 (GRCm39) S270R probably benign Het
Other mutations in Kmt2d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Kmt2d APN 15 98,760,214 (GRCm39) missense unknown
IGL00927:Kmt2d APN 15 98,742,890 (GRCm39) unclassified probably benign
IGL01123:Kmt2d APN 15 98,735,029 (GRCm39) missense unknown
IGL01288:Kmt2d APN 15 98,762,925 (GRCm39) missense probably damaging 1.00
IGL01538:Kmt2d APN 15 98,758,538 (GRCm39) unclassified probably benign
IGL01575:Kmt2d APN 15 98,744,736 (GRCm39) utr 3 prime probably benign
IGL01584:Kmt2d APN 15 98,754,250 (GRCm39) unclassified probably benign
IGL01750:Kmt2d APN 15 98,751,049 (GRCm39) unclassified probably benign
IGL02163:Kmt2d APN 15 98,733,109 (GRCm39) unclassified probably benign
IGL02209:Kmt2d APN 15 98,752,448 (GRCm39) unclassified probably benign
IGL02253:Kmt2d APN 15 98,756,056 (GRCm39) unclassified probably benign
IGL02271:Kmt2d APN 15 98,764,309 (GRCm39) missense possibly damaging 0.89
IGL02291:Kmt2d APN 15 98,763,373 (GRCm39) splice site probably benign
IGL02448:Kmt2d APN 15 98,741,991 (GRCm39) unclassified probably benign
IGL02472:Kmt2d APN 15 98,747,958 (GRCm39) missense probably benign 0.23
IGL02496:Kmt2d APN 15 98,755,439 (GRCm39) unclassified probably benign
IGL02527:Kmt2d APN 15 98,739,628 (GRCm39) unclassified probably benign
IGL02576:Kmt2d APN 15 98,762,001 (GRCm39) missense unknown
IGL02597:Kmt2d APN 15 98,761,712 (GRCm39) missense unknown
IGL02609:Kmt2d APN 15 98,749,674 (GRCm39) unclassified probably benign
IGL03085:Kmt2d APN 15 98,737,821 (GRCm39) unclassified probably benign
IGL03102:Kmt2d APN 15 98,753,424 (GRCm39) missense probably benign
IGL03123:Kmt2d APN 15 98,759,652 (GRCm39) missense unknown
G1citation:Kmt2d UTSW 15 98,747,340 (GRCm39) unclassified probably benign
R0091:Kmt2d UTSW 15 98,742,360 (GRCm39) unclassified probably benign
R0136:Kmt2d UTSW 15 98,752,159 (GRCm39) unclassified probably benign
R0243:Kmt2d UTSW 15 98,748,018 (GRCm39) unclassified probably benign
R0276:Kmt2d UTSW 15 98,748,192 (GRCm39) unclassified probably benign
R0477:Kmt2d UTSW 15 98,751,462 (GRCm39) unclassified probably benign
R0478:Kmt2d UTSW 15 98,751,462 (GRCm39) unclassified probably benign
R0586:Kmt2d UTSW 15 98,733,088 (GRCm39) unclassified probably benign
R0632:Kmt2d UTSW 15 98,751,462 (GRCm39) unclassified probably benign
R0678:Kmt2d UTSW 15 98,748,294 (GRCm39) unclassified probably benign
R0780:Kmt2d UTSW 15 98,760,738 (GRCm39) missense unknown
R0891:Kmt2d UTSW 15 98,750,572 (GRCm39) unclassified probably benign
R1136:Kmt2d UTSW 15 98,755,646 (GRCm39) unclassified probably benign
R1417:Kmt2d UTSW 15 98,764,311 (GRCm39) missense probably damaging 0.99
R1499:Kmt2d UTSW 15 98,742,819 (GRCm39) unclassified probably benign
R1510:Kmt2d UTSW 15 98,754,258 (GRCm39) unclassified probably benign
R1586:Kmt2d UTSW 15 98,762,934 (GRCm39) splice site probably benign
R1640:Kmt2d UTSW 15 98,742,938 (GRCm39) unclassified probably benign
R1714:Kmt2d UTSW 15 98,760,831 (GRCm39) missense unknown
R1725:Kmt2d UTSW 15 98,743,115 (GRCm39) unclassified probably benign
R1728:Kmt2d UTSW 15 98,763,013 (GRCm39) missense probably damaging 1.00
R1729:Kmt2d UTSW 15 98,763,013 (GRCm39) missense probably damaging 1.00
R1741:Kmt2d UTSW 15 98,743,115 (GRCm39) unclassified probably benign
R1744:Kmt2d UTSW 15 98,762,928 (GRCm39) missense probably damaging 0.99
R1746:Kmt2d UTSW 15 98,762,259 (GRCm39) missense probably damaging 0.97
R1753:Kmt2d UTSW 15 98,741,363 (GRCm39) unclassified probably benign
R1782:Kmt2d UTSW 15 98,755,429 (GRCm39) unclassified probably benign
R1789:Kmt2d UTSW 15 98,749,955 (GRCm39) unclassified probably benign
R1802:Kmt2d UTSW 15 98,760,866 (GRCm39) missense unknown
R1808:Kmt2d UTSW 15 98,764,567 (GRCm39) missense probably damaging 1.00
R1822:Kmt2d UTSW 15 98,759,661 (GRCm39) missense unknown
R1831:Kmt2d UTSW 15 98,753,224 (GRCm39) missense probably damaging 0.97
R1920:Kmt2d UTSW 15 98,753,472 (GRCm39) missense probably damaging 1.00
R1920:Kmt2d UTSW 15 98,753,471 (GRCm39) missense probably damaging 0.96
R1956:Kmt2d UTSW 15 98,757,471 (GRCm39) unclassified probably benign
R2100:Kmt2d UTSW 15 98,744,361 (GRCm39) unclassified probably benign
R2120:Kmt2d UTSW 15 98,737,410 (GRCm39) unclassified probably benign
R2188:Kmt2d UTSW 15 98,737,181 (GRCm39) unclassified probably benign
R2191:Kmt2d UTSW 15 98,758,930 (GRCm39) critical splice donor site probably null
R2234:Kmt2d UTSW 15 98,763,129 (GRCm39) missense probably damaging 0.98
R2422:Kmt2d UTSW 15 98,760,147 (GRCm39) missense unknown
R2762:Kmt2d UTSW 15 98,749,936 (GRCm39) unclassified probably benign
R2895:Kmt2d UTSW 15 98,741,820 (GRCm39) unclassified probably benign
R3624:Kmt2d UTSW 15 98,740,783 (GRCm39) unclassified probably benign
R3791:Kmt2d UTSW 15 98,742,030 (GRCm39) unclassified probably benign
R3794:Kmt2d UTSW 15 98,735,240 (GRCm39) unclassified probably benign
R3871:Kmt2d UTSW 15 98,748,902 (GRCm39) unclassified probably benign
R3958:Kmt2d UTSW 15 98,753,430 (GRCm39) missense possibly damaging 0.69
R3983:Kmt2d UTSW 15 98,743,927 (GRCm39) unclassified probably benign
R4211:Kmt2d UTSW 15 98,738,070 (GRCm39) unclassified probably benign
R4212:Kmt2d UTSW 15 98,742,884 (GRCm39) unclassified probably benign
R4240:Kmt2d UTSW 15 98,742,452 (GRCm39) unclassified probably benign
R4246:Kmt2d UTSW 15 98,737,970 (GRCm39) unclassified probably benign
R4361:Kmt2d UTSW 15 98,761,551 (GRCm39) missense unknown
R4388:Kmt2d UTSW 15 98,751,507 (GRCm39) unclassified probably benign
R4602:Kmt2d UTSW 15 98,748,140 (GRCm39) unclassified probably benign
R4606:Kmt2d UTSW 15 98,737,597 (GRCm39) unclassified probably benign
R4658:Kmt2d UTSW 15 98,750,410 (GRCm39) unclassified probably benign
R4840:Kmt2d UTSW 15 98,759,775 (GRCm39) missense unknown
R4895:Kmt2d UTSW 15 98,742,368 (GRCm39) unclassified probably benign
R4906:Kmt2d UTSW 15 98,747,420 (GRCm39) unclassified probably benign
R4976:Kmt2d UTSW 15 98,745,075 (GRCm39) utr 3 prime probably benign
R5093:Kmt2d UTSW 15 98,754,043 (GRCm39) missense probably damaging 1.00
R5119:Kmt2d UTSW 15 98,745,075 (GRCm39) utr 3 prime probably benign
R5160:Kmt2d UTSW 15 98,738,105 (GRCm39) unclassified probably benign
R5260:Kmt2d UTSW 15 98,740,741 (GRCm39) unclassified probably benign
R5274:Kmt2d UTSW 15 98,752,111 (GRCm39) unclassified probably benign
R5450:Kmt2d UTSW 15 98,752,967 (GRCm39) missense probably damaging 1.00
R5461:Kmt2d UTSW 15 98,749,990 (GRCm39) unclassified probably benign
R5462:Kmt2d UTSW 15 98,749,990 (GRCm39) unclassified probably benign
R5463:Kmt2d UTSW 15 98,749,990 (GRCm39) unclassified probably benign
R5465:Kmt2d UTSW 15 98,749,990 (GRCm39) unclassified probably benign
R5467:Kmt2d UTSW 15 98,749,990 (GRCm39) unclassified probably benign
R5481:Kmt2d UTSW 15 98,759,886 (GRCm39) missense unknown
R5509:Kmt2d UTSW 15 98,737,557 (GRCm39) unclassified probably benign
R5534:Kmt2d UTSW 15 98,735,238 (GRCm39) unclassified probably benign
R5536:Kmt2d UTSW 15 98,749,990 (GRCm39) unclassified probably benign
R5537:Kmt2d UTSW 15 98,749,990 (GRCm39) unclassified probably benign
R5538:Kmt2d UTSW 15 98,749,990 (GRCm39) unclassified probably benign
R5546:Kmt2d UTSW 15 98,750,949 (GRCm39) unclassified probably benign
R5595:Kmt2d UTSW 15 98,747,905 (GRCm39) unclassified probably benign
R5645:Kmt2d UTSW 15 98,742,278 (GRCm39) unclassified probably benign
R5679:Kmt2d UTSW 15 98,752,153 (GRCm39) unclassified probably benign
R5710:Kmt2d UTSW 15 98,751,987 (GRCm39) unclassified probably benign
R5755:Kmt2d UTSW 15 98,761,527 (GRCm39) missense unknown
R5817:Kmt2d UTSW 15 98,760,244 (GRCm39) missense unknown
R5841:Kmt2d UTSW 15 98,749,990 (GRCm39) unclassified probably benign
R5842:Kmt2d UTSW 15 98,749,990 (GRCm39) unclassified probably benign
R5843:Kmt2d UTSW 15 98,749,990 (GRCm39) unclassified probably benign
R5844:Kmt2d UTSW 15 98,749,990 (GRCm39) unclassified probably benign
R5845:Kmt2d UTSW 15 98,749,990 (GRCm39) unclassified probably benign
R6122:Kmt2d UTSW 15 98,758,573 (GRCm39) unclassified probably benign
R6612:Kmt2d UTSW 15 98,743,739 (GRCm39) unclassified probably benign
R6718:Kmt2d UTSW 15 98,748,420 (GRCm39) unclassified probably benign
R6718:Kmt2d UTSW 15 98,747,467 (GRCm39) unclassified probably benign
R6822:Kmt2d UTSW 15 98,747,340 (GRCm39) unclassified probably benign
R6866:Kmt2d UTSW 15 98,755,274 (GRCm39) unclassified probably benign
R6950:Kmt2d UTSW 15 98,737,901 (GRCm39) unclassified probably benign
R7089:Kmt2d UTSW 15 98,748,153 (GRCm39) missense unknown
R7120:Kmt2d UTSW 15 98,758,946 (GRCm39) missense unknown
R7131:Kmt2d UTSW 15 98,747,497 (GRCm39) unclassified probably benign
R7177:Kmt2d UTSW 15 98,748,267 (GRCm39) missense unknown
R7194:Kmt2d UTSW 15 98,741,714 (GRCm39) missense unknown
R7252:Kmt2d UTSW 15 98,742,147 (GRCm39) missense unknown
R7282:Kmt2d UTSW 15 98,751,985 (GRCm39) missense unknown
R7307:Kmt2d UTSW 15 98,747,299 (GRCm39) missense unknown
R7313:Kmt2d UTSW 15 98,754,504 (GRCm39) missense unknown
R7394:Kmt2d UTSW 15 98,754,265 (GRCm39) missense unknown
R7404:Kmt2d UTSW 15 98,743,376 (GRCm39) missense unknown
R7409:Kmt2d UTSW 15 98,753,235 (GRCm39) missense probably damaging 1.00
R7414:Kmt2d UTSW 15 98,737,737 (GRCm39) missense unknown
R7534:Kmt2d UTSW 15 98,749,899 (GRCm39) missense unknown
R7575:Kmt2d UTSW 15 98,747,492 (GRCm39) unclassified probably benign
R7687:Kmt2d UTSW 15 98,760,001 (GRCm39) missense unknown
R7699:Kmt2d UTSW 15 98,741,600 (GRCm39) missense unknown
R7700:Kmt2d UTSW 15 98,741,600 (GRCm39) missense unknown
R7765:Kmt2d UTSW 15 98,750,215 (GRCm39) missense unknown
R7797:Kmt2d UTSW 15 98,762,287 (GRCm39) missense probably benign 0.24
R7803:Kmt2d UTSW 15 98,760,804 (GRCm39) missense unknown
R7952:Kmt2d UTSW 15 98,748,649 (GRCm39) missense unknown
R8054:Kmt2d UTSW 15 98,741,806 (GRCm39) missense unknown
R8084:Kmt2d UTSW 15 98,739,945 (GRCm39) missense unknown
R8089:Kmt2d UTSW 15 98,740,750 (GRCm39) missense unknown
R8133:Kmt2d UTSW 15 98,762,823 (GRCm39) missense probably damaging 1.00
R8138:Kmt2d UTSW 15 98,741,534 (GRCm39) missense unknown
R8343:Kmt2d UTSW 15 98,750,478 (GRCm39) missense unknown
R8681:Kmt2d UTSW 15 98,743,948 (GRCm39) missense unknown
R8694:Kmt2d UTSW 15 98,742,615 (GRCm39) missense unknown
R8837:Kmt2d UTSW 15 98,762,048 (GRCm39) missense unknown
R8855:Kmt2d UTSW 15 98,754,237 (GRCm39) missense unknown
R8934:Kmt2d UTSW 15 98,759,767 (GRCm39) missense unknown
R9100:Kmt2d UTSW 15 98,747,832 (GRCm39) missense unknown
R9158:Kmt2d UTSW 15 98,741,020 (GRCm39) missense unknown
R9190:Kmt2d UTSW 15 98,749,896 (GRCm39) missense unknown
R9222:Kmt2d UTSW 15 98,747,324 (GRCm39) missense unknown
R9263:Kmt2d UTSW 15 98,747,499 (GRCm39) frame shift probably null
R9336:Kmt2d UTSW 15 98,743,697 (GRCm39) missense unknown
R9397:Kmt2d UTSW 15 98,747,994 (GRCm39) missense unknown
R9415:Kmt2d UTSW 15 98,737,586 (GRCm39) missense unknown
R9482:Kmt2d UTSW 15 98,763,046 (GRCm39) missense probably damaging 1.00
R9529:Kmt2d UTSW 15 98,737,649 (GRCm39) missense unknown
R9610:Kmt2d UTSW 15 98,743,057 (GRCm39) unclassified probably benign
R9611:Kmt2d UTSW 15 98,743,057 (GRCm39) unclassified probably benign
R9611:Kmt2d UTSW 15 98,743,054 (GRCm39) unclassified probably benign
R9612:Kmt2d UTSW 15 98,743,057 (GRCm39) unclassified probably benign
R9613:Kmt2d UTSW 15 98,743,057 (GRCm39) unclassified probably benign
R9644:Kmt2d UTSW 15 98,743,385 (GRCm39) missense unknown
R9716:Kmt2d UTSW 15 98,741,283 (GRCm39) missense unknown
R9763:Kmt2d UTSW 15 98,743,057 (GRCm39) unclassified probably benign
R9782:Kmt2d UTSW 15 98,764,597 (GRCm39) missense probably damaging 1.00
X0018:Kmt2d UTSW 15 98,750,803 (GRCm39) unclassified probably benign
X0024:Kmt2d UTSW 15 98,750,934 (GRCm39) unclassified probably benign
X0062:Kmt2d UTSW 15 98,747,700 (GRCm39) unclassified probably benign
Z1187:Kmt2d UTSW 15 98,749,625 (GRCm39) missense unknown
Z1188:Kmt2d UTSW 15 98,749,625 (GRCm39) missense unknown
Z1189:Kmt2d UTSW 15 98,749,625 (GRCm39) missense unknown
Z1190:Kmt2d UTSW 15 98,749,625 (GRCm39) missense unknown
Z1192:Kmt2d UTSW 15 98,749,625 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- AAGACCTTCAGGAGCCAGTC -3'
(R):5'- AGCCTAAGCCTCTATTCTTGAC -3'

Sequencing Primer
(F):5'- TCGATGGAGTTCCTCGCTGAC -3'
(R):5'- GACTACTGCATATTTTTCCAGGCAAC -3'
Posted On 2019-10-24