Mutagenetix > Incidental Mutations

Incidental Mutation 'R7650:Krt8'

590793

Institutional Source

Beutler Lab

Gene Symbol

Krt8

Ensembl Gene

ENSMUSG00000049382

Gene Name

keratin 8

Synonyms

Krt-2.8, Krt2-8, cytokeratin 8, cytokeratin8, K8, EndoA, cytokeratin-8, Card2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7650 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

101996698-102004482 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 102004163 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 26 (T26M)

Ref Sequence

ENSEMBL: ENSMUSP00000023952 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023952]

AlphaFold

P11679

Predicted Effect

probably benign
Transcript: ENSMUST00000023952
AA Change: T26M

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000023952
Gene: ENSMUSG00000049382
AA Change: T26M

Domain	Start	End	E-Value	Type
Pfam:Keratin_2_head	1	93	9.4e-18	PFAM
Filament	96	407	7.82e-188	SMART
low complexity region	421	438	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

100% (80/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the type II keratin family clustered on the long arm of chromosome 12. Type I and type II keratins heteropolymerize to form intermediate-sized filaments in the cytoplasm of epithelial cells. The product of this gene typically dimerizes with keratin 18 to form an intermediate filament in simple single-layered epithelial cells. This protein plays a role in maintaining cellular structural integrity and also functions in signal transduction and cellular differentiation. Mutations in this gene cause cryptogenic cirrhosis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null allele show partial background-sensitive embryonic lethality, placental defects, impaired female fertility, abnormal hematopoiesis, diarrhea, colorectal hyperplasia, anorectal prolapse, and high liver sensitivity to toxins, apoptotic stimuli and diet-induced steatosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2200002J24Rik	G	A	7: 30,699,789	V3I	probably benign	Het
Adam33	T	C	2: 131,061,147	E59G	probably damaging	Het
Akap13	T	A	7: 75,643,454	V45E	probably benign	Het
Ap1s1	A	G	5: 137,045,533	S28P	probably benign	Het
Btnl2	T	C	17: 34,358,129	L86P	probably damaging	Het
Carm1	G	A	9: 21,580,372	V246I	probably benign	Het
Cdk5rap1	C	T	2: 154,354,116	D283N	probably benign	Het
Cfap58	C	A	19: 47,986,528	N709K	possibly damaging	Het
Col24a1	A	G	3: 145,314,453	D195G	probably benign	Het
Dcaf1	A	G	9: 106,838,344	D220G	probably benign	Het
Ddias	C	T	7: 92,858,935	G591R	probably benign	Het
Defb22	A	T	2: 152,486,103	I54K	probably benign	Het
Dennd4b	G	A	3: 90,268,749	W202*	probably null	Het
F2	T	C	2: 91,628,396	N523S	possibly damaging	Het
Fam186a	A	G	15: 99,939,907	Y2819H	unknown	Het
Fanca	A	T	8: 123,268,564		probably null	Het
Fezf2	T	C	14: 12,342,653	H404R	probably damaging	Het
Fry	A	G	5: 150,413,418	N1418S	probably damaging	Het
Gak	A	G	5: 108,584,295	S776P	probably benign	Het
Gbf1	A	G	19: 46,272,539	H1181R	probably damaging	Het
Gdf9	G	A	11: 53,437,098	E294K	probably benign	Het
Gje1	G	A	10: 14,716,424	R205*	probably null	Het
Gm12569	G	A	11: 51,234,786	E179K	possibly damaging	Het
Gm8206	T	C	14: 6,055,211		probably null	Het
Gpr162	T	A	6: 124,861,843		probably benign	Het
Gxylt1	C	T	15: 93,245,658	R363H	probably benign	Het
Hnrnph1	A	T	11: 50,383,899	M396L	probably benign	Het
Ice1	A	G	13: 70,589,797	V2177A	possibly damaging	Het
Ice1	T	A	13: 70,605,483	Q828L	probably damaging	Het
Il10	A	T	1: 131,021,455	T118S	probably benign	Het
Itpr2	C	T	6: 146,233,994	R1813Q	probably benign	Het
Kbtbd12	T	A	6: 88,618,548	Q100L	probably damaging	Het
Kin	A	G	2: 10,092,168	D276G	possibly damaging	Het
Klhl1	T	C	14: 96,346,943	T284A	probably damaging	Het
Kmt2d	C	T	15: 98,850,870	A2858T	unknown	Het
Lama3	T	A	18: 12,537,838	M827K	probably benign	Het
Lingo3	T	C	10: 80,835,763	N111S	probably damaging	Het
Megf10	GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA	GGCAGCAACAGCACCAGCAGCA	18: 57,293,999		probably benign	Het
Metap1	A	G	3: 138,466,367	V263A	probably damaging	Het
Muc5ac	A	G	7: 141,809,422	T2157A	unknown	Het
Myo1d	G	T	11: 80,601,684	H748Q	probably benign	Het
Nfkbiz	A	T	16: 55,817,839	N419K	probably benign	Het
Nol10	T	C	12: 17,362,682		probably null	Het
Nrcam	T	C	12: 44,547,322	L284P	probably damaging	Het
Nrp1	T	A	8: 128,498,014	W753R	possibly damaging	Het
Obscn	A	G	11: 59,060,994	S3978P	probably benign	Het
Olfr181	T	A	16: 58,926,053	R173*	probably null	Het
Olfr968	A	T	9: 39,771,873	F309Y	probably benign	Het
Opa3	C	A	7: 19,244,971	N120K	probably benign	Het
Pabpc1l	T	C	2: 164,049,590	L576S	probably benign	Het
Panx3	A	G	9: 37,661,405	L283S	probably damaging	Het
Pcdhb4	T	A	18: 37,309,614	V659E	probably damaging	Het
Pde4dip	A	T	3: 97,699,107		probably null	Het
Pkd1l3	T	C	8: 109,672,585	V2200A	probably benign	Het
Pkp3	G	A	7: 141,082,370	M112I	probably benign	Het
Prex2	T	C	1: 11,149,854	I683T	possibly damaging	Het
Psg22	C	A	7: 18,726,759	Q438K	possibly damaging	Het
Ptgir	T	C	7: 16,906,951	V56A	possibly damaging	Het
Pus7	G	T	5: 23,760,246	T304K	probably damaging	Het
Rab38	T	C	7: 88,430,429	Y10H	possibly damaging	Het
Ros1	C	T	10: 52,046,209	G2277D	probably benign	Het
Rpain	A	T	11: 70,970,445		probably benign	Het
Shh	C	A	5: 28,458,306	S288I	probably benign	Het
Slc26a5	C	T	5: 21,834,330	V259M	possibly damaging	Het
Slc4a7	G	A	14: 14,773,348	E773K	probably benign	Het
Slit1	T	A	19: 41,629,924	N771I	probably damaging	Het
Stim1	T	A	7: 102,428,827	S179T		Het
Syk	A	G	13: 52,611,095	D86G	probably benign	Het
Tmem132b	T	G	5: 125,787,010	S727A	probably benign	Het
Trim42	T	A	9: 97,363,148	Y533F	probably benign	Het
Trpm6	A	T	19: 18,876,013	D1799V	possibly damaging	Het
Ttc26	T	A	6: 38,395,040	N188K	probably benign	Het
Ube4a	A	T	9: 44,933,436	I839N	probably damaging	Het
Ugt2b36	A	G	5: 87,080,972	I404T	probably damaging	Het
Ushbp1	T	A	8: 71,390,924	Q290L	possibly damaging	Het
Vcl	T	A	14: 20,995,046	I273K	probably damaging	Het
Vmn2r73	T	A	7: 85,871,939	I274L	probably benign	Het
Zc3h7b	A	G	15: 81,793,650	D945G	possibly damaging	Het
Zfp454	A	G	11: 50,883,753	L31P	probably damaging	Het
Zfp536	C	A	7: 37,569,692	V100L	probably damaging	Het
Zfp942	A	T	17: 21,928,837	S270R	probably benign	Het

Other mutations in Krt8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00508:Krt8	APN	15	101998025	missense	probably benign
IGL01643:Krt8	APN	15	101997073	missense	possibly damaging	0.64
IGL01966:Krt8	APN	15	101997670	missense	probably benign	0.08
IGL02587:Krt8	APN	15	101998932	missense	probably benign	0.04
IGL03088:Krt8	APN	15	102000587	missense	possibly damaging	0.90
R0531:Krt8	UTSW	15	102001448	missense	probably benign	0.12
R1451:Krt8	UTSW	15	101998829	missense	possibly damaging	0.93
R2258:Krt8	UTSW	15	101998822	missense	probably benign
R2348:Krt8	UTSW	15	101998865	missense	probably benign	0.31
R2566:Krt8	UTSW	15	101998024	missense	probably benign	0.03
R3796:Krt8	UTSW	15	101999442	missense	probably benign	0.00
R4834:Krt8	UTSW	15	101998821	missense	probably damaging	1.00
R4965:Krt8	UTSW	15	101996951	missense	probably benign
R5212:Krt8	UTSW	15	101997967	missense	possibly damaging	0.52
R5249:Krt8	UTSW	15	101998440	missense	possibly damaging	0.69
R5419:Krt8	UTSW	15	102003902	missense	probably damaging	0.98
R5778:Krt8	UTSW	15	102003939	missense	probably damaging	0.99
R5997:Krt8	UTSW	15	102000594	missense	possibly damaging	0.77
R6503:Krt8	UTSW	15	101997934	missense	possibly damaging	0.66
R6683:Krt8	UTSW	15	101998004	missense	probably benign
R6812:Krt8	UTSW	15	101997979	missense	probably damaging	0.99
R6824:Krt8	UTSW	15	101998440	missense	possibly damaging	0.50
R6875:Krt8	UTSW	15	101997908	missense	probably benign	0.44
R8047:Krt8	UTSW	15	102003971	missense	probably damaging	0.99
R8559:Krt8	UTSW	15	102001544	missense	probably benign	0.03
R8826:Krt8	UTSW	15	102001435	missense	possibly damaging	0.89
R9146:Krt8	UTSW	15	101998935	missense	probably damaging	0.98
Z1177:Krt8	UTSW	15	101999435	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCTTCAAGGGGCTCAACAG -3'
(R):5'- CCTCTAGTGTCTAGCCACTCAG -3'

Sequencing Primer
(F):5'- GCTCAACAGGCTCTGGTTCAC -3'
(R):5'- CTAGTGTCTAGCCACTCAGGTAAG -3'

Posted On

2019-10-24