Incidental Mutation 'R7650:Slit1'
ID590802
Institutional Source Beutler Lab
Gene Symbol Slit1
Ensembl Gene ENSMUSG00000025020
Gene Nameslit guidance ligand 1
SynonymsSlil1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7650 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location41600257-41743665 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 41629924 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 771 (N771I)
Ref Sequence ENSEMBL: ENSMUSP00000025993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025993] [ENSMUST00000166496] [ENSMUST00000169141]
Predicted Effect probably damaging
Transcript: ENSMUST00000025993
AA Change: N771I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025993
Gene: ENSMUSG00000025020
AA Change: N771I

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
LRRNT 33 65 5.68e-9 SMART
LRR 59 83 4.58e1 SMART
LRR 84 107 4.7e0 SMART
LRR_TYP 108 131 1.95e-3 SMART
LRR 133 155 6.05e0 SMART
LRR 157 179 3.98e1 SMART
LRR_TYP 180 203 3.44e-4 SMART
LRRCT 215 264 3.51e-6 SMART
LRRNT 281 313 3e-8 SMART
LRR 307 331 6.41e1 SMART
LRR_TYP 332 355 8.22e-2 SMART
LRR_TYP 356 379 9.08e-4 SMART
LRR 380 403 2.82e0 SMART
LRR_TYP 404 427 5.42e-2 SMART
LRRCT 439 488 5.78e-7 SMART
LRRNT 512 544 1.04e-7 SMART
LRR_TYP 564 587 3.39e-3 SMART
LRR 589 611 2.08e1 SMART
LRR_TYP 612 635 1.56e-2 SMART
LRR_TYP 636 659 4.11e-2 SMART
LRRCT 671 720 2.89e-7 SMART
LRRNT 733 765 4.87e-8 SMART
LRR 783 806 1.22e1 SMART
LRR_TYP 807 830 9.73e-4 SMART
LRR_TYP 831 854 9.58e-3 SMART
LRRCT 866 915 5.6e-14 SMART
EGF 928 962 5.08e-7 SMART
EGF 967 1003 1.74e-5 SMART
EGF_CA 1005 1041 1.05e-8 SMART
EGF 1046 1081 1.21e-4 SMART
EGF_CA 1083 1119 3.64e-8 SMART
FOLN 1086 1108 8.44e0 SMART
FOLN 1127 1149 1.4e0 SMART
EGF 1127 1160 1.78e-2 SMART
LamG 1183 1319 4.43e-38 SMART
EGF 1338 1371 6.76e-3 SMART
EGF 1377 1410 3.38e-3 SMART
FOLN 1418 1440 2.25e1 SMART
EGF 1418 1451 1.28e-3 SMART
CT 1462 1531 3.15e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166496
AA Change: N771I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128381
Gene: ENSMUSG00000025020
AA Change: N771I

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
LRRNT 33 65 5.68e-9 SMART
LRR 59 83 4.58e1 SMART
LRR 84 107 4.7e0 SMART
LRR_TYP 108 131 1.95e-3 SMART
LRR 133 155 6.05e0 SMART
LRR 157 179 3.98e1 SMART
LRR_TYP 180 203 3.44e-4 SMART
LRRCT 215 264 3.51e-6 SMART
LRRNT 281 313 3e-8 SMART
LRR 307 331 6.41e1 SMART
LRR_TYP 332 355 8.22e-2 SMART
LRR_TYP 356 379 9.08e-4 SMART
LRR 380 403 2.82e0 SMART
LRR_TYP 404 427 5.42e-2 SMART
LRRCT 439 488 5.78e-7 SMART
LRRNT 512 544 1.04e-7 SMART
LRR_TYP 564 587 3.39e-3 SMART
LRR 589 611 2.08e1 SMART
LRR_TYP 612 635 1.56e-2 SMART
LRR_TYP 636 659 4.11e-2 SMART
LRRCT 671 720 2.89e-7 SMART
LRRNT 733 765 4.87e-8 SMART
LRR 783 806 1.22e1 SMART
LRR_TYP 807 830 9.73e-4 SMART
LRR_TYP 831 854 9.58e-3 SMART
LRRCT 866 915 5.6e-14 SMART
EGF 928 962 5.08e-7 SMART
EGF 967 1003 1.74e-5 SMART
EGF_CA 1005 1041 1.05e-8 SMART
EGF 1046 1081 1.21e-4 SMART
EGF_CA 1083 1119 3.64e-8 SMART
FOLN 1086 1108 8.44e0 SMART
FOLN 1127 1149 1.4e0 SMART
EGF 1127 1160 1.78e-2 SMART
LamG 1183 1319 4.43e-38 SMART
EGF 1338 1371 6.76e-3 SMART
EGF 1377 1410 3.38e-3 SMART
low complexity region 1437 1458 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169141
AA Change: N771I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129034
Gene: ENSMUSG00000025020
AA Change: N771I

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
LRRNT 33 65 5.68e-9 SMART
LRR 59 83 4.58e1 SMART
LRR 84 107 4.7e0 SMART
LRR_TYP 108 131 1.95e-3 SMART
LRR 133 155 6.05e0 SMART
LRR 157 179 3.98e1 SMART
LRR_TYP 180 203 3.44e-4 SMART
LRRCT 215 264 3.51e-6 SMART
LRRNT 281 313 3e-8 SMART
LRR 307 331 6.41e1 SMART
LRR_TYP 332 355 8.22e-2 SMART
LRR_TYP 356 379 9.08e-4 SMART
LRR 380 403 2.82e0 SMART
LRR_TYP 404 427 5.42e-2 SMART
LRRCT 439 488 5.78e-7 SMART
LRRNT 512 544 1.04e-7 SMART
LRR_TYP 564 587 3.39e-3 SMART
LRR 589 611 2.08e1 SMART
LRR_TYP 612 635 1.56e-2 SMART
LRR_TYP 636 659 4.11e-2 SMART
LRRCT 671 720 2.89e-7 SMART
LRRNT 733 765 4.87e-8 SMART
LRR 783 806 1.22e1 SMART
LRR_TYP 807 830 9.73e-4 SMART
LRR_TYP 831 854 9.58e-3 SMART
LRRCT 866 915 5.6e-14 SMART
EGF 928 962 5.08e-7 SMART
EGF 967 1003 1.74e-5 SMART
EGF_CA 1005 1041 1.05e-8 SMART
EGF 1046 1081 1.21e-4 SMART
EGF_CA 1083 1119 3.64e-8 SMART
FOLN 1086 1108 8.44e0 SMART
FOLN 1127 1149 1.4e0 SMART
EGF 1127 1160 1.78e-2 SMART
LamG 1183 1319 4.43e-38 SMART
EGF 1338 1371 6.76e-3 SMART
EGF 1377 1410 3.38e-3 SMART
FOLN 1418 1440 2.25e1 SMART
EGF 1418 1451 1.28e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (80/80)
MGI Phenotype PHENOTYPE: Mice homozygous for a reporter allele exhibit normal interneuron numbers and morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002J24Rik G A 7: 30,699,789 V3I probably benign Het
Adam33 T C 2: 131,061,147 E59G probably damaging Het
Akap13 T A 7: 75,643,454 V45E probably benign Het
Ap1s1 A G 5: 137,045,533 S28P probably benign Het
Btnl2 T C 17: 34,358,129 L86P probably damaging Het
Carm1 G A 9: 21,580,372 V246I probably benign Het
Cdk5rap1 C T 2: 154,354,116 D283N probably benign Het
Cfap58 C A 19: 47,986,528 N709K possibly damaging Het
Col24a1 A G 3: 145,314,453 D195G probably benign Het
Dcaf1 A G 9: 106,838,344 D220G probably benign Het
Ddias C T 7: 92,858,935 G591R probably benign Het
Defb22 A T 2: 152,486,103 I54K probably benign Het
Dennd4b G A 3: 90,268,749 W202* probably null Het
F2 T C 2: 91,628,396 N523S possibly damaging Het
Fam186a A G 15: 99,939,907 Y2819H unknown Het
Fanca A T 8: 123,268,564 probably null Het
Fezf2 T C 14: 12,342,653 H404R probably damaging Het
Fry A G 5: 150,413,418 N1418S probably damaging Het
Gak A G 5: 108,584,295 S776P probably benign Het
Gbf1 A G 19: 46,272,539 H1181R probably damaging Het
Gdf9 G A 11: 53,437,098 E294K probably benign Het
Gje1 G A 10: 14,716,424 R205* probably null Het
Gm12569 G A 11: 51,234,786 E179K possibly damaging Het
Gm8206 T C 14: 6,055,211 probably null Het
Gpr162 T A 6: 124,861,843 probably benign Het
Gxylt1 C T 15: 93,245,658 R363H probably benign Het
Hnrnph1 A T 11: 50,383,899 M396L probably benign Het
Ice1 A G 13: 70,589,797 V2177A possibly damaging Het
Ice1 T A 13: 70,605,483 Q828L probably damaging Het
Il10 A T 1: 131,021,455 T118S probably benign Het
Itpr2 C T 6: 146,233,994 R1813Q probably benign Het
Kbtbd12 T A 6: 88,618,548 Q100L probably damaging Het
Kin A G 2: 10,092,168 D276G possibly damaging Het
Klhl1 T C 14: 96,346,943 T284A probably damaging Het
Kmt2d C T 15: 98,850,870 A2858T unknown Het
Krt8 G A 15: 102,004,163 T26M probably benign Het
Lama3 T A 18: 12,537,838 M827K probably benign Het
Lingo3 T C 10: 80,835,763 N111S probably damaging Het
Megf10 GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA GGCAGCAACAGCACCAGCAGCA 18: 57,293,999 probably benign Het
Metap1 A G 3: 138,466,367 V263A probably damaging Het
Muc5ac A G 7: 141,809,422 T2157A unknown Het
Myo1d G T 11: 80,601,684 H748Q probably benign Het
Nfkbiz A T 16: 55,817,839 N419K probably benign Het
Nol10 T C 12: 17,362,682 probably null Het
Nrcam T C 12: 44,547,322 L284P probably damaging Het
Nrp1 T A 8: 128,498,014 W753R possibly damaging Het
Obscn A G 11: 59,060,994 S3978P probably benign Het
Olfr181 T A 16: 58,926,053 R173* probably null Het
Olfr968 A T 9: 39,771,873 F309Y probably benign Het
Opa3 C A 7: 19,244,971 N120K probably benign Het
Pabpc1l T C 2: 164,049,590 L576S probably benign Het
Panx3 A G 9: 37,661,405 L283S probably damaging Het
Pcdhb4 T A 18: 37,309,614 V659E probably damaging Het
Pde4dip A T 3: 97,699,107 probably null Het
Pkd1l3 T C 8: 109,672,585 V2200A probably benign Het
Pkp3 G A 7: 141,082,370 M112I probably benign Het
Prex2 T C 1: 11,149,854 I683T possibly damaging Het
Psg22 C A 7: 18,726,759 Q438K possibly damaging Het
Ptgir T C 7: 16,906,951 V56A possibly damaging Het
Pus7 G T 5: 23,760,246 T304K probably damaging Het
Rab38 T C 7: 88,430,429 Y10H possibly damaging Het
Ros1 C T 10: 52,046,209 G2277D probably benign Het
Rpain A T 11: 70,970,445 probably benign Het
Shh C A 5: 28,458,306 S288I probably benign Het
Slc26a5 C T 5: 21,834,330 V259M possibly damaging Het
Slc4a7 G A 14: 14,773,348 E773K probably benign Het
Stim1 T A 7: 102,428,827 S179T Het
Syk A G 13: 52,611,095 D86G probably benign Het
Tmem132b T G 5: 125,787,010 S727A probably benign Het
Trim42 T A 9: 97,363,148 Y533F probably benign Het
Trpm6 A T 19: 18,876,013 D1799V possibly damaging Het
Ttc26 T A 6: 38,395,040 N188K probably benign Het
Ube4a A T 9: 44,933,436 I839N probably damaging Het
Ugt2b36 A G 5: 87,080,972 I404T probably damaging Het
Ushbp1 T A 8: 71,390,924 Q290L possibly damaging Het
Vcl T A 14: 20,995,046 I273K probably damaging Het
Vmn2r73 T A 7: 85,871,939 I274L probably benign Het
Zc3h7b A G 15: 81,793,650 D945G possibly damaging Het
Zfp454 A G 11: 50,883,753 L31P probably damaging Het
Zfp536 C A 7: 37,569,692 V100L probably damaging Het
Zfp942 A T 17: 21,928,837 S270R probably benign Het
Other mutations in Slit1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Slit1 APN 19 41650835 missense probably damaging 1.00
IGL00515:Slit1 APN 19 41624501 missense probably damaging 0.97
IGL00909:Slit1 APN 19 41602255 missense possibly damaging 0.89
IGL00953:Slit1 APN 19 41602300 missense probably damaging 1.00
IGL01116:Slit1 APN 19 41606385 missense possibly damaging 0.93
IGL01457:Slit1 APN 19 41611044 missense probably damaging 1.00
IGL01688:Slit1 APN 19 41729106 missense probably damaging 1.00
IGL01720:Slit1 APN 19 41634214 missense probably benign 0.01
IGL01925:Slit1 APN 19 41608378 missense probably damaging 0.98
IGL02008:Slit1 APN 19 41646140 missense probably damaging 0.99
IGL02312:Slit1 APN 19 41601680 missense possibly damaging 0.66
IGL02398:Slit1 APN 19 41602237 missense probably damaging 1.00
IGL02542:Slit1 APN 19 41627248 missense probably damaging 1.00
IGL02559:Slit1 APN 19 41721085 missense probably benign 0.01
IGL02609:Slit1 APN 19 41602304 missense probably damaging 0.99
IGL02623:Slit1 APN 19 41651683 missense probably damaging 0.98
IGL02729:Slit1 APN 19 41603334 missense probably damaging 1.00
IGL03230:Slit1 APN 19 41729085 missense probably damaging 1.00
IGL03387:Slit1 APN 19 41603442 missense possibly damaging 0.57
PIT4576001:Slit1 UTSW 19 41624549 missense possibly damaging 0.52
R0366:Slit1 UTSW 19 41611031 missense probably damaging 1.00
R0432:Slit1 UTSW 19 41743293 missense probably damaging 0.98
R0496:Slit1 UTSW 19 41608311 splice site probably benign
R0722:Slit1 UTSW 19 41608435 missense probably damaging 1.00
R1468:Slit1 UTSW 19 41608384 missense probably damaging 1.00
R1468:Slit1 UTSW 19 41608384 missense probably damaging 1.00
R1488:Slit1 UTSW 19 41608385 missense probably damaging 1.00
R1615:Slit1 UTSW 19 41650671 splice site probably benign
R1694:Slit1 UTSW 19 41637592 missense possibly damaging 0.69
R1762:Slit1 UTSW 19 41603335 missense probably damaging 1.00
R1842:Slit1 UTSW 19 41721038 critical splice donor site probably null
R1844:Slit1 UTSW 19 41625573 missense probably damaging 1.00
R1940:Slit1 UTSW 19 41630776 missense probably damaging 1.00
R2087:Slit1 UTSW 19 41637483 missense probably benign 0.00
R2094:Slit1 UTSW 19 41606380 missense probably damaging 0.99
R2095:Slit1 UTSW 19 41606380 missense probably damaging 0.99
R2104:Slit1 UTSW 19 41602247 missense possibly damaging 0.69
R2305:Slit1 UTSW 19 41611016 missense probably benign 0.03
R2972:Slit1 UTSW 19 41611016 missense probably benign 0.03
R2973:Slit1 UTSW 19 41611016 missense probably benign 0.03
R2974:Slit1 UTSW 19 41611016 missense probably benign 0.03
R3159:Slit1 UTSW 19 41604373 missense probably benign
R3752:Slit1 UTSW 19 41646967 critical splice donor site probably null
R4095:Slit1 UTSW 19 41608486 intron probably benign
R4282:Slit1 UTSW 19 41614417 missense probably benign
R4417:Slit1 UTSW 19 41614469 missense probably damaging 1.00
R4607:Slit1 UTSW 19 41616793 missense probably benign 0.10
R4729:Slit1 UTSW 19 41647020 missense probably damaging 1.00
R4756:Slit1 UTSW 19 41649013 missense probably damaging 1.00
R4764:Slit1 UTSW 19 41721044 nonsense probably null
R4849:Slit1 UTSW 19 41649544 missense probably benign 0.17
R4874:Slit1 UTSW 19 41729054 critical splice donor site probably null
R5581:Slit1 UTSW 19 41616663 critical splice donor site probably null
R5699:Slit1 UTSW 19 41625520 critical splice donor site probably null
R5888:Slit1 UTSW 19 41743296 missense probably damaging 1.00
R5906:Slit1 UTSW 19 41606374 missense probably damaging 1.00
R6176:Slit1 UTSW 19 41637595 missense probably damaging 1.00
R6277:Slit1 UTSW 19 41600509 missense possibly damaging 0.81
R6702:Slit1 UTSW 19 41614870 missense possibly damaging 0.95
R6860:Slit1 UTSW 19 41616715 missense probably benign 0.10
R7015:Slit1 UTSW 19 41629886 nonsense probably null
R7172:Slit1 UTSW 19 41634666 missense probably damaging 1.00
R7512:Slit1 UTSW 19 41600635 missense probably damaging 1.00
R7568:Slit1 UTSW 19 41601635 missense probably damaging 1.00
R7614:Slit1 UTSW 19 41634200 missense probably damaging 1.00
R7687:Slit1 UTSW 19 41650689 missense probably benign 0.03
R7732:Slit1 UTSW 19 41604408 missense probably benign 0.01
R7947:Slit1 UTSW 19 41610808 missense probably damaging 1.00
R7947:Slit1 UTSW 19 41610809 missense probably benign
R8171:Slit1 UTSW 19 41727073 missense probably damaging 0.97
R8217:Slit1 UTSW 19 41624520 missense possibly damaging 0.60
X0023:Slit1 UTSW 19 41601640 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGCATCTGCCCACAAATGG -3'
(R):5'- AGAACTCTTGCCGCCTTTG -3'

Sequencing Primer
(F):5'- CCACAAATGGGAGACTCCTGG -3'
(R):5'- TCTCAGGGAAAGCAGTGCCTTATC -3'
Posted On2019-10-24