Incidental Mutation 'R7650:Gbf1'
ID590803
Institutional Source Beutler Lab
Gene Symbol Gbf1
Ensembl Gene ENSMUSG00000025224
Gene Namegolgi-specific brefeldin A-resistance factor 1
Synonyms1700083E03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7650 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location46152509-46286510 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46272539 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 1181 (H1181R)
Ref Sequence ENSEMBL: ENSMUSP00000026254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026254] [ENSMUST00000176992]
Predicted Effect probably damaging
Transcript: ENSMUST00000026254
AA Change: H1181R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026254
Gene: ENSMUSG00000025224
AA Change: H1181R

DomainStartEndE-ValueType
low complexity region 270 288 N/A INTRINSIC
Pfam:Sec7_N 400 551 3.4e-29 PFAM
Sec7 696 884 8.55e-91 SMART
low complexity region 1198 1216 N/A INTRINSIC
low complexity region 1281 1296 N/A INTRINSIC
low complexity region 1773 1793 N/A INTRINSIC
low complexity region 1802 1820 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176992
AA Change: H1127R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135062
Gene: ENSMUSG00000025224
AA Change: H1127R

DomainStartEndE-ValueType
low complexity region 216 234 N/A INTRINSIC
Pfam:Sec7_N 343 498 1.5e-35 PFAM
Sec7 642 830 8.55e-91 SMART
low complexity region 1144 1162 N/A INTRINSIC
low complexity region 1227 1242 N/A INTRINSIC
low complexity region 1715 1735 N/A INTRINSIC
low complexity region 1744 1762 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177512
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Sec7 domain family. The encoded protein is a guanine nucleotide exchange factor that regulates the recruitment of proteins to membranes by mediating GDP to GTP exchange. The encoded protein is localized to the Golgi apparatus and plays a role in vesicular trafficking by activating ADP ribosylation factor 1. The encoded protein has also been identified as an important host factor for viral replication. Multiple transcript variants have been observed for this gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002J24Rik G A 7: 30,699,789 V3I probably benign Het
Adam33 T C 2: 131,061,147 E59G probably damaging Het
Akap13 T A 7: 75,643,454 V45E probably benign Het
Ap1s1 A G 5: 137,045,533 S28P probably benign Het
Btnl2 T C 17: 34,358,129 L86P probably damaging Het
Carm1 G A 9: 21,580,372 V246I probably benign Het
Cdk5rap1 C T 2: 154,354,116 D283N probably benign Het
Cfap58 C A 19: 47,986,528 N709K possibly damaging Het
Col24a1 A G 3: 145,314,453 D195G probably benign Het
Dcaf1 A G 9: 106,838,344 D220G probably benign Het
Ddias C T 7: 92,858,935 G591R probably benign Het
Defb22 A T 2: 152,486,103 I54K probably benign Het
Dennd4b G A 3: 90,268,749 W202* probably null Het
F2 T C 2: 91,628,396 N523S possibly damaging Het
Fam186a A G 15: 99,939,907 Y2819H unknown Het
Fanca A T 8: 123,268,564 probably null Het
Fezf2 T C 14: 12,342,653 H404R probably damaging Het
Fry A G 5: 150,413,418 N1418S probably damaging Het
Gak A G 5: 108,584,295 S776P probably benign Het
Gdf9 G A 11: 53,437,098 E294K probably benign Het
Gje1 G A 10: 14,716,424 R205* probably null Het
Gm12569 G A 11: 51,234,786 E179K possibly damaging Het
Gm8206 T C 14: 6,055,211 probably null Het
Gpr162 T A 6: 124,861,843 probably benign Het
Gxylt1 C T 15: 93,245,658 R363H probably benign Het
Hnrnph1 A T 11: 50,383,899 M396L probably benign Het
Ice1 A G 13: 70,589,797 V2177A possibly damaging Het
Ice1 T A 13: 70,605,483 Q828L probably damaging Het
Il10 A T 1: 131,021,455 T118S probably benign Het
Itpr2 C T 6: 146,233,994 R1813Q probably benign Het
Kbtbd12 T A 6: 88,618,548 Q100L probably damaging Het
Kin A G 2: 10,092,168 D276G possibly damaging Het
Klhl1 T C 14: 96,346,943 T284A probably damaging Het
Kmt2d C T 15: 98,850,870 A2858T unknown Het
Krt8 G A 15: 102,004,163 T26M probably benign Het
Lama3 T A 18: 12,537,838 M827K probably benign Het
Lingo3 T C 10: 80,835,763 N111S probably damaging Het
Megf10 GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA GGCAGCAACAGCACCAGCAGCA 18: 57,293,999 probably benign Het
Metap1 A G 3: 138,466,367 V263A probably damaging Het
Muc5ac A G 7: 141,809,422 T2157A unknown Het
Myo1d G T 11: 80,601,684 H748Q probably benign Het
Nfkbiz A T 16: 55,817,839 N419K probably benign Het
Nol10 T C 12: 17,362,682 probably null Het
Nrcam T C 12: 44,547,322 L284P probably damaging Het
Nrp1 T A 8: 128,498,014 W753R possibly damaging Het
Obscn A G 11: 59,060,994 S3978P probably benign Het
Olfr181 T A 16: 58,926,053 R173* probably null Het
Olfr968 A T 9: 39,771,873 F309Y probably benign Het
Opa3 C A 7: 19,244,971 N120K probably benign Het
Pabpc1l T C 2: 164,049,590 L576S probably benign Het
Panx3 A G 9: 37,661,405 L283S probably damaging Het
Pcdhb4 T A 18: 37,309,614 V659E probably damaging Het
Pde4dip A T 3: 97,699,107 probably null Het
Pkd1l3 T C 8: 109,672,585 V2200A probably benign Het
Pkp3 G A 7: 141,082,370 M112I probably benign Het
Prex2 T C 1: 11,149,854 I683T possibly damaging Het
Psg22 C A 7: 18,726,759 Q438K possibly damaging Het
Ptgir T C 7: 16,906,951 V56A possibly damaging Het
Pus7 G T 5: 23,760,246 T304K probably damaging Het
Rab38 T C 7: 88,430,429 Y10H possibly damaging Het
Ros1 C T 10: 52,046,209 G2277D probably benign Het
Rpain A T 11: 70,970,445 probably benign Het
Shh C A 5: 28,458,306 S288I probably benign Het
Slc26a5 C T 5: 21,834,330 V259M possibly damaging Het
Slc4a7 G A 14: 14,773,348 E773K probably benign Het
Slit1 T A 19: 41,629,924 N771I probably damaging Het
Stim1 T A 7: 102,428,827 S179T Het
Syk A G 13: 52,611,095 D86G probably benign Het
Tmem132b T G 5: 125,787,010 S727A probably benign Het
Trim42 T A 9: 97,363,148 Y533F probably benign Het
Trpm6 A T 19: 18,876,013 D1799V possibly damaging Het
Ttc26 T A 6: 38,395,040 N188K probably benign Het
Ube4a A T 9: 44,933,436 I839N probably damaging Het
Ugt2b36 A G 5: 87,080,972 I404T probably damaging Het
Ushbp1 T A 8: 71,390,924 Q290L possibly damaging Het
Vcl T A 14: 20,995,046 I273K probably damaging Het
Vmn2r73 T A 7: 85,871,939 I274L probably benign Het
Zc3h7b A G 15: 81,793,650 D945G possibly damaging Het
Zfp454 A G 11: 50,883,753 L31P probably damaging Het
Zfp536 C A 7: 37,569,692 V100L probably damaging Het
Zfp942 A T 17: 21,928,837 S270R probably benign Het
Other mutations in Gbf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Gbf1 APN 19 46284249 critical splice acceptor site probably null
IGL00988:Gbf1 APN 19 46284120 critical splice donor site probably null
IGL01352:Gbf1 APN 19 46265215 missense probably damaging 1.00
IGL01432:Gbf1 APN 19 46279995 missense probably damaging 1.00
IGL01469:Gbf1 APN 19 46279364 missense probably damaging 1.00
IGL01870:Gbf1 APN 19 46285669 missense probably benign 0.00
IGL02019:Gbf1 APN 19 46279292 missense possibly damaging 0.93
IGL02061:Gbf1 APN 19 46279258 missense possibly damaging 0.65
IGL02126:Gbf1 APN 19 46252117 missense probably damaging 0.97
IGL02272:Gbf1 APN 19 46269803 missense probably damaging 1.00
IGL02346:Gbf1 APN 19 46285930 missense probably damaging 1.00
IGL02491:Gbf1 APN 19 46262540 unclassified probably benign
IGL03003:Gbf1 APN 19 46255655 missense probably damaging 1.00
IGL03130:Gbf1 APN 19 46267348 missense possibly damaging 0.82
IGL03376:Gbf1 APN 19 46262521 missense possibly damaging 0.94
PIT4651001:Gbf1 UTSW 19 46163543 missense probably benign
R0107:Gbf1 UTSW 19 46284828 missense probably benign
R0139:Gbf1 UTSW 19 46261792 missense probably damaging 1.00
R0180:Gbf1 UTSW 19 46285722 missense probably benign
R0255:Gbf1 UTSW 19 46254110 splice site probably benign
R0317:Gbf1 UTSW 19 46254020 missense probably benign
R0329:Gbf1 UTSW 19 46272270 critical splice donor site probably null
R0372:Gbf1 UTSW 19 46285704 missense probably benign
R0666:Gbf1 UTSW 19 46262544 unclassified probably benign
R1463:Gbf1 UTSW 19 46271545 unclassified probably benign
R1701:Gbf1 UTSW 19 46261675 missense probably damaging 1.00
R1848:Gbf1 UTSW 19 46272037 missense possibly damaging 0.90
R1962:Gbf1 UTSW 19 46267219 missense probably damaging 1.00
R1965:Gbf1 UTSW 19 46271564 missense probably damaging 1.00
R1966:Gbf1 UTSW 19 46271564 missense probably damaging 1.00
R2177:Gbf1 UTSW 19 46265670 missense probably benign
R2238:Gbf1 UTSW 19 46163618 missense probably benign
R2239:Gbf1 UTSW 19 46163618 missense probably benign
R2520:Gbf1 UTSW 19 46265367 missense probably benign
R3821:Gbf1 UTSW 19 46264807 missense probably damaging 0.99
R4681:Gbf1 UTSW 19 46280550 missense probably benign 0.41
R4695:Gbf1 UTSW 19 46259167 nonsense probably null
R4785:Gbf1 UTSW 19 46268395 missense possibly damaging 0.89
R5202:Gbf1 UTSW 19 46268454 missense probably benign 0.13
R5359:Gbf1 UTSW 19 46283725 critical splice donor site probably null
R5468:Gbf1 UTSW 19 46284296 missense possibly damaging 0.92
R5593:Gbf1 UTSW 19 46272524 missense possibly damaging 0.91
R5595:Gbf1 UTSW 19 46284422 missense possibly damaging 0.74
R5796:Gbf1 UTSW 19 46284343 missense probably benign 0.08
R5938:Gbf1 UTSW 19 46268452 missense probably damaging 1.00
R5957:Gbf1 UTSW 19 46246221 critical splice donor site probably null
R6059:Gbf1 UTSW 19 46265248 missense probably damaging 1.00
R6120:Gbf1 UTSW 19 46279321 missense possibly damaging 0.83
R6239:Gbf1 UTSW 19 46259696 missense probably benign 0.00
R6252:Gbf1 UTSW 19 46271556 missense probably benign 0.33
R6310:Gbf1 UTSW 19 46280005 missense probably damaging 0.96
R6787:Gbf1 UTSW 19 46271772 missense probably benign
R6805:Gbf1 UTSW 19 46262507 missense probably damaging 1.00
R6855:Gbf1 UTSW 19 46279941 missense probably benign 0.00
R7313:Gbf1 UTSW 19 46280354 missense possibly damaging 0.94
R7414:Gbf1 UTSW 19 46283358 nonsense probably null
R7646:Gbf1 UTSW 19 46283672 missense probably damaging 1.00
R7789:Gbf1 UTSW 19 46254002 missense probably damaging 1.00
R7801:Gbf1 UTSW 19 46272643 missense probably benign 0.03
R8241:Gbf1 UTSW 19 46246137 missense probably damaging 1.00
Z1177:Gbf1 UTSW 19 46259142 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGAGCTTGTGCAAAAGGCTG -3'
(R):5'- TAGCTGCTACTGTGGCCTTAG -3'

Sequencing Primer
(F):5'- AGCCATCTTGCTGAGCAG -3'
(R):5'- GCCTTAGCCCCTTGCATACTTG -3'
Posted On2019-10-24