Incidental Mutation 'R7651:Ccdc27'
ID590819
Institutional Source Beutler Lab
Gene Symbol Ccdc27
Ensembl Gene ENSMUSG00000039492
Gene Namecoiled-coil domain containing 27
SynonymsLOC381580
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R7651 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location154026639-154042677 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 154028099 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 573 (I573N)
Ref Sequence ENSEMBL: ENSMUSP00000039642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047207] [ENSMUST00000125533] [ENSMUST00000126119] [ENSMUST00000130175] [ENSMUST00000131325] [ENSMUST00000132541] [ENSMUST00000139569] [ENSMUST00000143047] [ENSMUST00000145527] [ENSMUST00000146054] [ENSMUST00000146426] [ENSMUST00000146543] [ENSMUST00000182151] [ENSMUST00000182191]
Predicted Effect probably damaging
Transcript: ENSMUST00000047207
AA Change: I573N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039642
Gene: ENSMUSG00000039492
AA Change: I573N

DomainStartEndE-ValueType
low complexity region 39 53 N/A INTRINSIC
coiled coil region 203 243 N/A INTRINSIC
low complexity region 305 320 N/A INTRINSIC
low complexity region 329 358 N/A INTRINSIC
coiled coil region 390 575 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125533
SMART Domains Protein: ENSMUSP00000138324
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126119
SMART Domains Protein: ENSMUSP00000138560
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130175
SMART Domains Protein: ENSMUSP00000138675
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131325
SMART Domains Protein: ENSMUSP00000138777
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132541
SMART Domains Protein: ENSMUSP00000138471
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139569
Predicted Effect probably benign
Transcript: ENSMUST00000143047
SMART Domains Protein: ENSMUSP00000138733
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145527
SMART Domains Protein: ENSMUSP00000138448
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146054
SMART Domains Protein: ENSMUSP00000138605
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146426
Predicted Effect probably benign
Transcript: ENSMUST00000146543
SMART Domains Protein: ENSMUSP00000138267
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182151
SMART Domains Protein: ENSMUSP00000138692
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182191
SMART Domains Protein: ENSMUSP00000138710
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik T G 11: 58,293,362 V302G Het
A230072I06Rik T C 8: 12,279,689 I48T unknown Het
A430089I19Rik T C 5: 94,303,377 T297A probably benign Het
Ada T A 2: 163,732,355 D127V probably damaging Het
Alb G C 5: 90,467,355 R242P probably damaging Het
Ankrd34c T C 9: 89,729,410 R293G possibly damaging Het
Ap2b1 T C 11: 83,339,430 probably null Het
Arhgef16 A G 4: 154,291,067 S157P probably damaging Het
Atp2b1 C T 10: 99,016,968 L1036F probably damaging Het
Cep164 T C 9: 45,773,852 E869G probably benign Het
Colq A T 14: 31,528,335 V381D possibly damaging Het
Drc1 A G 5: 30,359,614 E519G probably benign Het
Drosha G A 15: 12,859,436 V577I probably benign Het
Epg5 C T 18: 77,981,400 Q1157* probably null Het
Eqtn T C 4: 94,923,707 S150G possibly damaging Het
Fam216a G A 5: 122,367,382 H172Y probably damaging Het
Fbxw19 T A 9: 109,494,646 D87V probably damaging Het
Fgr A T 4: 132,995,013 I198F probably damaging Het
Flnc A G 6: 29,444,050 D621G probably benign Het
Flt3 A C 5: 147,354,922 Y573D probably damaging Het
Git2 A T 5: 114,733,235 I603N probably damaging Het
Gm4559 C T 7: 142,273,816 R183K unknown Het
Gnb5 T C 9: 75,343,571 F326L probably damaging Het
Grm8 A T 6: 27,760,258 W358R possibly damaging Het
Grrp1 C T 4: 134,251,648 R173H probably damaging Het
Hoxa3 A G 6: 52,172,273 V126A unknown Het
Hras T C 7: 141,192,151 T144A possibly damaging Het
Hyal1 G A 9: 107,578,370 R293H probably damaging Het
Ifnlr1 A G 4: 135,690,608 S49G possibly damaging Het
Ighv8-11 C A 12: 115,567,385 C41F probably benign Het
Jakmip1 A G 5: 37,134,273 T689A probably damaging Het
Kcnb1 T C 2: 167,188,361 H88R probably damaging Het
Kcnt2 T A 1: 140,570,461 M892K probably benign Het
Lrba C A 3: 86,741,466 S2507* probably null Het
Mbp C T 18: 82,554,374 T65I probably damaging Het
Muc2 A T 7: 141,704,201 Y12F Het
Muc4 T A 16: 32,756,575 S80T Het
Muc5ac A G 7: 141,796,254 D579G possibly damaging Het
Muc5b A G 7: 141,864,023 T3569A possibly damaging Het
Myb C T 10: 21,156,374 R36H probably damaging Het
Myo6 T C 9: 80,264,266 probably null Het
Ogfod1 T C 8: 94,037,353 V22A probably benign Het
Orai3 A G 7: 127,774,064 I246V probably damaging Het
Otog A G 7: 46,241,761 M68V probably benign Het
Pcdh20 T A 14: 88,469,153 D237V probably damaging Het
Pcdhb18 T C 18: 37,490,993 F459L probably benign Het
Pik3c2g C T 6: 139,622,072 T62M possibly damaging Het
Plaa T C 4: 94,582,639 Y420C probably damaging Het
Ppp1r9b C T 11: 95,001,942 A656V probably benign Het
Prg4 T A 1: 150,454,945 E659V unknown Het
Prlhr C A 19: 60,467,145 A328S probably benign Het
Prlr A T 15: 10,328,378 D313V probably benign Het
Prune2 C T 19: 17,120,408 T1092I probably damaging Het
Psme4 T A 11: 30,837,334 L1043H probably damaging Het
Ptprr T C 10: 116,251,179 V521A probably benign Het
Rab44 A T 17: 29,148,205 D703V unknown Het
Rpl9-ps1 A T 11: 83,645,085 Y179* probably null Het
Scg3 T A 9: 75,682,050 N107I probably benign Het
Sh3bgrl2 T C 9: 83,548,472 V5A possibly damaging Het
Slc7a12 T C 3: 14,481,449 V218A probably benign Het
Sorcs2 A G 5: 36,027,978 L918P probably damaging Het
Sox1 C A 8: 12,396,686 A109E probably damaging Het
Syne1 T A 10: 5,205,074 M5622L probably benign Het
Syne1 A T 10: 5,343,416 L1305Q probably damaging Het
Tacc2 A T 7: 130,623,154 H523L probably benign Het
Tas1r2 A T 4: 139,669,627 D788V probably benign Het
Tcl1b5 T A 12: 105,176,435 D7E possibly damaging Het
Tesc A G 5: 118,056,601 D159G possibly damaging Het
Tm2d2 G T 8: 25,017,300 probably benign Het
Tnfrsf11a T A 1: 105,809,446 C93S probably damaging Het
Tnfsf4 T C 1: 161,417,022 V94A probably benign Het
Trav13n-3 T A 14: 53,337,507 Y69N probably benign Het
Utp20 T C 10: 88,754,595 D2339G probably benign Het
Vmn1r225 A G 17: 20,502,349 I17M possibly damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r114 G T 17: 23,291,012 Y831* probably null Het
Vmn2r72 T A 7: 85,751,938 N91I probably damaging Het
Zfp846 T C 9: 20,588,512 S13P possibly damaging Het
Zfp934 G T 13: 62,518,513 N116K probably benign Het
Other mutations in Ccdc27
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4466001:Ccdc27 UTSW 4 154041727 missense unknown
PIT4472001:Ccdc27 UTSW 4 154041727 missense unknown
R0078:Ccdc27 UTSW 4 154035738 splice site probably benign
R0883:Ccdc27 UTSW 4 154036484 missense unknown
R1389:Ccdc27 UTSW 4 154041769 missense unknown
R1773:Ccdc27 UTSW 4 154041765 missense unknown
R1869:Ccdc27 UTSW 4 154026763 splice site probably null
R2020:Ccdc27 UTSW 4 154033313 missense probably null 0.05
R2070:Ccdc27 UTSW 4 154041813 missense unknown
R2131:Ccdc27 UTSW 4 154036306 small deletion probably benign
R3825:Ccdc27 UTSW 4 154036285 missense unknown
R4183:Ccdc27 UTSW 4 154036306 small deletion probably benign
R4254:Ccdc27 UTSW 4 154039519 missense unknown
R5932:Ccdc27 UTSW 4 154026774 missense probably benign 0.22
R6269:Ccdc27 UTSW 4 154037722 missense unknown
R6324:Ccdc27 UTSW 4 154036191 missense probably benign 0.02
R6761:Ccdc27 UTSW 4 154037698 missense unknown
R7090:Ccdc27 UTSW 4 154028066 missense probably benign 0.03
R7163:Ccdc27 UTSW 4 154032825 missense not run
R7488:Ccdc27 UTSW 4 154032967 missense probably benign 0.22
R7555:Ccdc27 UTSW 4 154041817 missense unknown
R7826:Ccdc27 UTSW 4 154039501 critical splice donor site probably null
R8250:Ccdc27 UTSW 4 154041788 missense unknown
R8815:Ccdc27 UTSW 4 154026748 missense probably benign 0.02
R8835:Ccdc27 UTSW 4 154042566 missense unknown
RF016:Ccdc27 UTSW 4 154036110 missense probably benign 0.04
Z1177:Ccdc27 UTSW 4 154036471 missense unknown
Predicted Primers PCR Primer
(F):5'- TAGCCTGGTCTCAAGGACTG -3'
(R):5'- AAGGAACTGGGCTTCGATCC -3'

Sequencing Primer
(F):5'- ACTGTCCTGGGGTTACAGTGC -3'
(R):5'- GAACTGGGCTTCGATCCAGAATATTC -3'
Posted On2019-10-24