Incidental Mutation 'R7651:Pik3c2g'
ID590833
Institutional Source Beutler Lab
Gene Symbol Pik3c2g
Ensembl Gene ENSMUSG00000030228
Gene Namephosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 gamma
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R7651 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location139587221-139969284 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 139622072 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 62 (T62M)
Ref Sequence ENSEMBL: ENSMUSP00000141141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032353] [ENSMUST00000185968] [ENSMUST00000187618] [ENSMUST00000188066] [ENSMUST00000190962]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032353
AA Change: T62M

PolyPhen 2 Score 0.850 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000032353
Gene: ENSMUSG00000030228
AA Change: T62M

DomainStartEndE-ValueType
SCOP:d1e8xa3 223 344 4e-33 SMART
Blast:PI3K_rbd 272 345 7e-44 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000185968
AA Change: T62M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000140368
Gene: ENSMUSG00000030228
AA Change: T62M

DomainStartEndE-ValueType
SCOP:d1e8xa3 223 371 2e-42 SMART
Blast:PI3K_rbd 272 371 2e-64 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000187618
AA Change: T62M

PolyPhen 2 Score 0.850 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000141025
Gene: ENSMUSG00000030228
AA Change: T62M

DomainStartEndE-ValueType
SCOP:d1e8xa3 223 344 4e-33 SMART
Blast:PI3K_rbd 272 345 7e-44 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000188066
AA Change: T62M

PolyPhen 2 Score 0.850 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000190962
AA Change: T62M

PolyPhen 2 Score 0.850 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000141141
Gene: ENSMUSG00000030228
AA Change: T62M

DomainStartEndE-ValueType
SCOP:d1e8xa3 223 344 4e-33 SMART
Blast:PI3K_rbd 272 345 7e-44 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. This gene may play a role in several diseases, including type II diabetes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allelel exhibit reduced liver glucogen accumulation, hyperlipidemia, adiposity and insulin resistance with age or after consumption of a high-fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik T G 11: 58,293,362 V302G Het
A230072I06Rik T C 8: 12,279,689 I48T unknown Het
A430089I19Rik T C 5: 94,303,377 T297A probably benign Het
Ada T A 2: 163,732,355 D127V probably damaging Het
Alb G C 5: 90,467,355 R242P probably damaging Het
Ankrd34c T C 9: 89,729,410 R293G possibly damaging Het
Ap2b1 T C 11: 83,339,430 probably null Het
Arhgef16 A G 4: 154,291,067 S157P probably damaging Het
Atp2b1 C T 10: 99,016,968 L1036F probably damaging Het
Ccdc27 A T 4: 154,028,099 I573N probably damaging Het
Cep164 T C 9: 45,773,852 E869G probably benign Het
Colq A T 14: 31,528,335 V381D possibly damaging Het
Drc1 A G 5: 30,359,614 E519G probably benign Het
Drosha G A 15: 12,859,436 V577I probably benign Het
Epg5 C T 18: 77,981,400 Q1157* probably null Het
Eqtn T C 4: 94,923,707 S150G possibly damaging Het
Fam216a G A 5: 122,367,382 H172Y probably damaging Het
Fbxw19 T A 9: 109,494,646 D87V probably damaging Het
Fgr A T 4: 132,995,013 I198F probably damaging Het
Flnc A G 6: 29,444,050 D621G probably benign Het
Flt3 A C 5: 147,354,922 Y573D probably damaging Het
Git2 A T 5: 114,733,235 I603N probably damaging Het
Gm4559 C T 7: 142,273,816 R183K unknown Het
Gnb5 T C 9: 75,343,571 F326L probably damaging Het
Grm8 A T 6: 27,760,258 W358R possibly damaging Het
Grrp1 C T 4: 134,251,648 R173H probably damaging Het
Hoxa3 A G 6: 52,172,273 V126A unknown Het
Hras T C 7: 141,192,151 T144A possibly damaging Het
Hyal1 G A 9: 107,578,370 R293H probably damaging Het
Ifnlr1 A G 4: 135,690,608 S49G possibly damaging Het
Ighv8-11 C A 12: 115,567,385 C41F probably benign Het
Jakmip1 A G 5: 37,134,273 T689A probably damaging Het
Kcnb1 T C 2: 167,188,361 H88R probably damaging Het
Kcnt2 T A 1: 140,570,461 M892K probably benign Het
Lrba C A 3: 86,741,466 S2507* probably null Het
Mbp C T 18: 82,554,374 T65I probably damaging Het
Muc2 A T 7: 141,704,201 Y12F Het
Muc4 T A 16: 32,756,575 S80T Het
Muc5ac A G 7: 141,796,254 D579G possibly damaging Het
Muc5b A G 7: 141,864,023 T3569A possibly damaging Het
Myb C T 10: 21,156,374 R36H probably damaging Het
Myo6 T C 9: 80,264,266 probably null Het
Ogfod1 T C 8: 94,037,353 V22A probably benign Het
Orai3 A G 7: 127,774,064 I246V probably damaging Het
Otog A G 7: 46,241,761 M68V probably benign Het
Pcdh20 T A 14: 88,469,153 D237V probably damaging Het
Pcdhb18 T C 18: 37,490,993 F459L probably benign Het
Plaa T C 4: 94,582,639 Y420C probably damaging Het
Ppp1r9b C T 11: 95,001,942 A656V probably benign Het
Prg4 T A 1: 150,454,945 E659V unknown Het
Prlhr C A 19: 60,467,145 A328S probably benign Het
Prlr A T 15: 10,328,378 D313V probably benign Het
Prune2 C T 19: 17,120,408 T1092I probably damaging Het
Psme4 T A 11: 30,837,334 L1043H probably damaging Het
Ptprr T C 10: 116,251,179 V521A probably benign Het
Rab44 A T 17: 29,148,205 D703V unknown Het
Rpl9-ps1 A T 11: 83,645,085 Y179* probably null Het
Scg3 T A 9: 75,682,050 N107I probably benign Het
Sh3bgrl2 T C 9: 83,548,472 V5A possibly damaging Het
Slc7a12 T C 3: 14,481,449 V218A probably benign Het
Sorcs2 A G 5: 36,027,978 L918P probably damaging Het
Sox1 C A 8: 12,396,686 A109E probably damaging Het
Syne1 T A 10: 5,205,074 M5622L probably benign Het
Syne1 A T 10: 5,343,416 L1305Q probably damaging Het
Tacc2 A T 7: 130,623,154 H523L probably benign Het
Tas1r2 A T 4: 139,669,627 D788V probably benign Het
Tcl1b5 T A 12: 105,176,435 D7E possibly damaging Het
Tesc A G 5: 118,056,601 D159G possibly damaging Het
Tm2d2 G T 8: 25,017,300 probably benign Het
Tnfrsf11a T A 1: 105,809,446 C93S probably damaging Het
Tnfsf4 T C 1: 161,417,022 V94A probably benign Het
Trav13n-3 T A 14: 53,337,507 Y69N probably benign Het
Utp20 T C 10: 88,754,595 D2339G probably benign Het
Vmn1r225 A G 17: 20,502,349 I17M possibly damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r114 G T 17: 23,291,012 Y831* probably null Het
Vmn2r72 T A 7: 85,751,938 N91I probably damaging Het
Zfp846 T C 9: 20,588,512 S13P possibly damaging Het
Zfp934 G T 13: 62,518,513 N116K probably benign Het
Other mutations in Pik3c2g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Pik3c2g APN 6 139896125 missense probably damaging 1.00
IGL01355:Pik3c2g APN 6 139852857 missense probably damaging 0.98
IGL01579:Pik3c2g APN 6 139754741 nonsense probably null
IGL01580:Pik3c2g APN 6 139622516 missense probably damaging 0.99
IGL01587:Pik3c2g APN 6 139754741 nonsense probably null
IGL01813:Pik3c2g APN 6 139622409 missense possibly damaging 0.55
IGL02218:Pik3c2g APN 6 139860355 missense probably damaging 1.00
IGL02479:Pik3c2g APN 6 139918004 missense probably benign 0.40
IGL02480:Pik3c2g APN 6 139852800 missense probably damaging 1.00
IGL02721:Pik3c2g APN 6 139736973 missense probably benign 0.15
IGL02967:Pik3c2g APN 6 139967828 missense probably damaging 0.98
IGL03221:Pik3c2g APN 6 139772407 critical splice acceptor site probably null
FR4304:Pik3c2g UTSW 6 139635656 frame shift probably null
FR4340:Pik3c2g UTSW 6 139635656 frame shift probably null
FR4976:Pik3c2g UTSW 6 139635654 frame shift probably null
IGL02837:Pik3c2g UTSW 6 139626564 nonsense probably null
PIT4531001:Pik3c2g UTSW 6 139859370 missense
R0002:Pik3c2g UTSW 6 139768745 missense probably benign 0.08
R0081:Pik3c2g UTSW 6 139957793 missense probably benign 0.05
R0098:Pik3c2g UTSW 6 139662443 missense unknown
R0719:Pik3c2g UTSW 6 139629725 missense probably damaging 1.00
R0740:Pik3c2g UTSW 6 139633793 critical splice donor site probably null
R0837:Pik3c2g UTSW 6 139957699 splice site probably benign
R0840:Pik3c2g UTSW 6 139896072 missense probably damaging 1.00
R1306:Pik3c2g UTSW 6 139772428 missense probably benign
R1501:Pik3c2g UTSW 6 139844070 critical splice donor site probably null
R1591:Pik3c2g UTSW 6 139748178 missense probably benign 0.00
R1666:Pik3c2g UTSW 6 139635636 intron probably benign
R1907:Pik3c2g UTSW 6 139844042 missense probably damaging 1.00
R1970:Pik3c2g UTSW 6 139900386 critical splice donor site probably null
R1982:Pik3c2g UTSW 6 139622548 missense probably damaging 0.97
R2171:Pik3c2g UTSW 6 139855286 nonsense probably null
R2188:Pik3c2g UTSW 6 139852874 missense probably damaging 1.00
R3777:Pik3c2g UTSW 6 139622387 missense probably damaging 1.00
R3778:Pik3c2g UTSW 6 139622387 missense probably damaging 1.00
R3965:Pik3c2g UTSW 6 139855292 missense possibly damaging 0.90
R4076:Pik3c2g UTSW 6 139852863 missense probably damaging 1.00
R4078:Pik3c2g UTSW 6 139635610 intron probably benign
R4108:Pik3c2g UTSW 6 139730370 missense probably benign 0.00
R4461:Pik3c2g UTSW 6 139841681 intron probably benign
R4474:Pik3c2g UTSW 6 139633751 missense probably damaging 0.99
R4509:Pik3c2g UTSW 6 139720006 missense probably benign 0.25
R4646:Pik3c2g UTSW 6 139720018 missense probably benign 0.05
R4732:Pik3c2g UTSW 6 139935985 missense probably benign 0.28
R4733:Pik3c2g UTSW 6 139935985 missense probably benign 0.28
R4854:Pik3c2g UTSW 6 139768779 missense probably damaging 1.00
R4928:Pik3c2g UTSW 6 139967802 missense possibly damaging 0.88
R4959:Pik3c2g UTSW 6 139843931 missense possibly damaging 0.65
R4973:Pik3c2g UTSW 6 139843931 missense possibly damaging 0.65
R5032:Pik3c2g UTSW 6 139896202 missense probably benign 0.00
R5071:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5072:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5073:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5074:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5107:Pik3c2g UTSW 6 139635625 intron probably benign
R5186:Pik3c2g UTSW 6 139622018 missense probably damaging 1.00
R5253:Pik3c2g UTSW 6 139896257 critical splice donor site probably null
R5359:Pik3c2g UTSW 6 139622123 missense probably damaging 1.00
R5394:Pik3c2g UTSW 6 139720082 missense probably benign
R5417:Pik3c2g UTSW 6 139736943 missense probably benign
R5435:Pik3c2g UTSW 6 139715855 unclassified probably null
R5580:Pik3c2g UTSW 6 139626533 missense probably damaging 0.99
R5664:Pik3c2g UTSW 6 139737007 missense probably damaging 0.98
R5908:Pik3c2g UTSW 6 139768710 missense probably damaging 1.00
R5914:Pik3c2g UTSW 6 139622479 missense probably benign 0.00
R6046:Pik3c2g UTSW 6 139622139 missense probably damaging 0.96
R6046:Pik3c2g UTSW 6 139896792 missense probably damaging 1.00
R6298:Pik3c2g UTSW 6 139626563 missense probably damaging 1.00
R6382:Pik3c2g UTSW 6 139719998 missense possibly damaging 0.88
R6480:Pik3c2g UTSW 6 139730469 missense probably benign 0.27
R6917:Pik3c2g UTSW 6 139896173 missense probably benign 0.00
R6929:Pik3c2g UTSW 6 139957776 missense possibly damaging 0.67
R7022:Pik3c2g UTSW 6 139622063 missense possibly damaging 0.82
R7144:Pik3c2g UTSW 6 139629870 missense probably damaging 1.00
R7213:Pik3c2g UTSW 6 139860264 missense
R7215:Pik3c2g UTSW 6 139754863 missense
R7332:Pik3c2g UTSW 6 139896255 missense
R7357:Pik3c2g UTSW 6 139633793 critical splice donor site probably null
R7359:Pik3c2g UTSW 6 139967894 missense unknown
R7385:Pik3c2g UTSW 6 139855353 missense
R7455:Pik3c2g UTSW 6 139967917 missense unknown
R7888:Pik3c2g UTSW 6 139896744 missense
R8005:Pik3c2g UTSW 6 139622069 missense probably benign 0.01
RF015:Pik3c2g UTSW 6 139754771 missense
RF032:Pik3c2g UTSW 6 139635658 frame shift probably null
X0024:Pik3c2g UTSW 6 139860258 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATACAGTTGGCAAACAGAGC -3'
(R):5'- ATGCCATGATATTTTCCACTGGG -3'

Sequencing Primer
(F):5'- GAGCCAAATCGCACTGAAC -3'
(R):5'- TCCACTGGGATTTCTCCAGGAAG -3'
Posted On2019-10-24